Incidental Mutations

64 incidental mutations are currently displayed, and affect 64 genes.
16 are Possibly Damaging.
25 are Probably Damaging.
16 are Probably Benign.
6 are Probably Null.
4 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 64 of 64] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 617897 UTSW 1700012B09Rik R8030 G1 225.01 N 9 14761674 S98P A G missense Het probably benign 0.000 01/23/2020
2 617914 UTSW 2410089E03Rik 1.000 R8030 G1 225.01 N 15 8230303 G2383V G T missense Het probably damaging 0.999 phenotype 01/23/2020
3 617907 UTSW Abca9 0.000 R8030 G1 225.01 N 11 110120708 V1170I C T missense Het probably benign 0.000 phenotype 01/23/2020
4 617885 UTSW Acacb 0.000 R8030 G1 225.01 N 5 114233167 T1786A A G missense Het probably damaging 0.999 phenotype 01/23/2020
5 617864 UTSW Acmsd 0.000 R8030 G1 225.01 N 1 127749161 I141T T C missense Het possibly damaging 0.503 phenotype 01/23/2020
6 617910 UTSW Akr1c12 0.000 R8030 G1 225.01 N 13 4272245 V266A A G missense Het possibly damaging 0.929 01/23/2020
7 617895 UTSW Arhgef18 1.000 R8030 G1 225.01 N 8 3439600 I311F A T missense Het probably damaging 1.000 phenotype 01/23/2020
8 617901 UTSW Armc2 1.000 R8030 G1 225.01 N 10 41966742 N355I T A missense Het possibly damaging 0.733 01/23/2020
9 617882 UTSW Armh1 0.082 R8030 G1 225.01 N 4 117229987 K160N T A missense Het probably benign 0.307 01/23/2020
10 617918 UTSW Asic1 0.202 R8030 G1 225.01 N 15 99694841 T236S A T missense Het possibly damaging 0.556 phenotype 01/23/2020
11 617888 UTSW Avl9 0.211 R8030 G1 225.01 N 6 56741422 D424E T A missense Het probably damaging 0.991 01/23/2020
12 617875 UTSW Cbfa2t2 0.731 R8030 G1 225.01 N 2 154515896 Q197L A T missense Het probably damaging 0.964 phenotype 01/23/2020
13 617887 UTSW Ccdc136 0.000 R8030 G1 225.01 N 6 29417142 V654A T C missense Het probably benign 0.068 01/23/2020
14 617893 UTSW Ccdc155 0.000 R8030 G1 217.47 N 7 45188184 CGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTC CGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTCAGGCTC small insertion Het probably benign phenotype 01/23/2020
15 617892 UTSW Cd177 0.477 R8030 G1 225.01 N 7 24756169 W309* C T nonsense Het probably null phenotype 01/23/2020
16 617889 UTSW Cracr2a 0.000 R8030 G1 225.01 N 6 127611423 K182E A G missense Het probably damaging 0.957 01/23/2020
17 617915 UTSW Dpys 0.149 R8030 G1 225.01 N 15 39828090 T279A T C missense Het possibly damaging 0.761 phenotype 01/23/2020
18 617924 UTSW Dsc1 0.078 R8030 G1 225.01 N 18 20089571 S615T A T missense Het probably benign 0.000 phenotype 01/23/2020
19 617923 UTSW Dsc2 0.000 R8030 G1 225.01 N 18 20032274 G881R C T missense Het possibly damaging 0.783 phenotype 01/23/2020
20 617881 UTSW Efcab14 0.000 R8030 G1 225.01 N 4 115766402 Q390R A G missense Het probably benign 0.073 01/23/2020
21 617902 UTSW Eif4ebp2 0.000 R8030 G1 225.01 N 10 61435046 A68V G A missense Het probably damaging 0.995 phenotype 01/23/2020
22 617898 UTSW Fam81a 0.063 R8030 G1 225.01 N 9 70102909 S149P A G missense Het probably benign 0.112 01/23/2020
23 617927 UTSW Ffar4 0.110 R8030 G1 225.01 N 19 38107391 I193V A G missense Het possibly damaging 0.796 phenotype 01/23/2020
24 617908 UTSW Flvcr2 0.843 R8030 G1 225.01 N 12 85798538 V377D T A missense Het probably damaging 0.970 phenotype 01/23/2020
25 617886 UTSW Fscn1 0.467 R8030 G1 225.01 N 5 142961001 R185C C T missense Het possibly damaging 0.951 phenotype 01/23/2020
26 617913 UTSW Gucy1b2 0.193 R8030 G1 225.01 N 14 62392870 S809N C T missense Het probably benign 0.000 phenotype 01/23/2020
27 617900 UTSW H60b 0.068 R8030 G1 225.01 N 10 22287121 N198K T A missense Het probably damaging 0.962 01/23/2020
28 617876 UTSW Helz2 0.000 R8030 G1 225.01 N 2 181237896 F643Y A T missense Het possibly damaging 0.546 phenotype 01/23/2020
29 617869 UTSW Kif28 0.498 R8030 G1 225.01 N 1 179699064 V846A A G missense Het probably benign 0.042 01/23/2020
30 617878 UTSW Kirrel 1.000 R8030 G1 225.01 N 3 87097775 G89W C A missense Het probably damaging 1.000 phenotype 01/23/2020
31 617906 UTSW Krt42 0.082 R8030 G1 225.01 N 11 100265039 R294G G C missense Het possibly damaging 0.671 01/23/2020
32 617920 UTSW Mb21d2 0.000 R8030 G1 225.01 N 16 28827803 F473S A G missense Het probably damaging 1.000 01/23/2020
33 617921 UTSW Mcrip2 0.117 R8030 G1 225.01 N 17 25864332 Q111* G A nonsense Het probably null 01/23/2020
34 617922 UTSW Msh5 0.000 R8030 G1 225.01 N 17 35029748 Y741H A G missense Het possibly damaging 0.954 phenotype 01/23/2020
35 617925 UTSW Myo7b 0.000 R8030 G1 225.01 N 18 31998082 I544T A G missense Het probably damaging 0.960 phenotype 01/23/2020
36 617865 UTSW Nav1 0.933 R8030 G1 225.01 N 1 135537239 E276G T C missense Het probably damaging 1.000 phenotype 01/23/2020
37 617912 UTSW Nr2f1 1.000 R8030 G1 225.01 N 13 78195446 N233S T C missense Het probably benign 0.361 phenotype 01/23/2020
38 617890 UTSW Nrip2 0.150 R8030 G1 225.01 N 6 128406521 D124V A T missense Het possibly damaging 0.925 01/23/2020
39 617871 UTSW Olfr1008 0.089 R8030 G1 225.01 N 2 85689719 C97S T A missense Het probably damaging 0.997 phenotype 01/23/2020
40 617872 UTSW Olfr1042 0.067 R8030 G1 225.01 N 2 86160242 V43I C T missense Het probably benign 0.000 phenotype 01/23/2020
41 617917 UTSW Panx2 0.000 R8030 G1 225.01 N 15 89068079 A250S G T missense Het probably damaging 1.000 phenotype 01/23/2020
42 617866 UTSW Pdc 0.101 R8030 G1 225.01 N 1 150333213 L149P T C missense Het probably damaging 1.000 phenotype 01/23/2020
43 617877 UTSW Pex5l 0.597 R8030 G1 225.01 N 3 32954419 I445F T A missense Het possibly damaging 0.929 phenotype 01/23/2020
44 617868 UTSW Pigc 0.000 R8030 G1 225.01 N 1 161970547 F33L T C missense Het probably damaging 1.000 phenotype 01/23/2020
45 617919 UTSW Pkp2 1.000 R8030 G1 225.01 N 16 16246910 M433L A T missense Het probably benign 0.000 phenotype 01/23/2020
46 617916 UTSW Rbfox2 0.712 R8030 G1 225.01 N 15 77085576 A G critical splice donor site 2 bp Het probably null phenotype 01/23/2020
47 617909 UTSW Rd3l 0.094 R8030 G1 225.01 N 12 111980150 L64P A G missense Het possibly damaging 0.483 01/23/2020
48 617883 UTSW Rnf220 0.842 R8030 G1 225.01 N 4 117277828 Y409H A G missense Het probably damaging 0.999 01/23/2020
49 617894 UTSW Rsf1 1.000 R8030 G1 214.46 N 7 97579909 G GACGGCGGCC unclassified Het probably benign phenotype 01/23/2020
50 617874 UTSW Sel1l2 0.445 R8030 G1 225.01 N 2 140241018 T567A T C missense Het probably damaging 0.973 01/23/2020
51 617926 UTSW Slc22a8 0.000 R8030 G1 225.01 N 19 8610007 I477T T C missense Het probably damaging 0.989 phenotype 01/23/2020
52 617899 UTSW Sltm 0.964 R8030 G1 225.01 N 9 70585979 R753* C T nonsense Het probably null 01/23/2020
53 617903 UTSW Specc1l 0.605 R8030 G1 225.01 N 10 75248555 M687K T A missense Het probably damaging 0.998 phenotype 01/23/2020
54 617896 UTSW Spock3 0.000 R8030 G1 225.01 N 8 63352198 C338G T G missense Het probably damaging 1.000 phenotype 01/23/2020
55 617905 UTSW Ssh2 0.266 R8030 G1 225.01 N 11 77454506 Q1106K C A missense Het probably benign 0.008 phenotype 01/23/2020
56 617911 UTSW Sycp2l 0.131 R8030 G1 225.01 N 13 41172670 M251V A G missense Het not run phenotype 01/23/2020
57 617867 UTSW Tdrd5 0.258 R8030 G1 225.01 N 1 156270595 E711* C A nonsense Het probably null phenotype 01/23/2020
58 617904 UTSW Thop1 0.465 R8030 G1 190.01 N 10 81075616 M112T T C missense Het possibly damaging 0.909 phenotype 01/23/2020
59 617879 UTSW Tln1 1.000 R8030 G1 225.01 N 4 43535737 C T critical splice donor site 1 bp Het probably null phenotype 01/23/2020
60 617884 UTSW Ttc28 0.000 R8030 G1 225.01 N 5 111286056 I2319L A C missense Het possibly damaging 0.810 01/23/2020
61 617870 UTSW Ttll11 0.000 R8030 G1 225.01 N 2 35902673 I386T A G missense Het probably damaging 1.000 01/23/2020
62 617880 UTSW Txndc8 0.168 R8030 G1 225.01 N 4 57984178 E151G T C missense Het probably damaging 0.977 01/23/2020
63 617873 UTSW Ubr1 0.611 R8030 G1 225.01 N 2 120934374 E533G T C missense Het probably damaging 0.987 phenotype 01/23/2020
64 617891 UTSW Zscan4f R8030 G1 225.01 N 7 11401363 H232R A G missense Het probably benign 0.013 01/23/2020
[records 1 to 64 of 64]