Incidental Mutations

87 incidental mutations are currently displayed, and affect 87 genes.
10 are Possibly Damaging.
30 are Probably Damaging.
35 are Probably Benign.
9 are Probably Null.
4 create premature stop codons.
3 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 87 of 87] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 618379 UTSW 4932438A13Rik 1.000 R8039 G1 225.01 N 3 36943214 V1140E T A missense Het probably benign 0.116 phenotype 01/23/2020
2 618445 UTSW Abca17 0.000 R8039 G1 225.01 N 17 24328725 H225R T C missense Het probably damaging 0.997 01/23/2020
3 618390 UTSW Adgrb2 0.000 R8039 G1 225.01 N 4 130022268 L1451Q T A missense Het probably damaging 0.994 phenotype 01/23/2020
4 618443 UTSW Afdn 1.000 R8039 G1 225.01 N 17 13899141 L1713P T C missense Het probably damaging 0.993 phenotype 01/23/2020
5 618431 UTSW Agr2 0.478 R8039 G1 225.01 N 12 35995559 I15F A T missense Het probably benign 0.101 phenotype 01/23/2020
6 618393 UTSW Agrn 0.514 R8039 G1 225.01 N 4 156169011 T1808A T C missense Het probably benign 0.119 phenotype 01/23/2020
7 618432 UTSW Akap6 0.759 R8039 G1 225.01 N 12 53141676 I1958V A G missense Het probably benign 0.004 phenotype 01/23/2020
8 618376 UTSW Ankrd60 0.000 R8039 G1 225.01 N 2 173572491 C A critical splice donor site 1 bp Het probably null 01/23/2020
9 618406 UTSW Anpep 0.000 R8039 G1 225.01 N 7 79839400 A G critical splice donor site 2 bp Het probably null phenotype 01/23/2020
10 618420 UTSW Apoa4 0.109 R8039 G1 225.01 N 9 46242293 D64V A T missense Het possibly damaging 0.696 phenotype 01/23/2020
11 618380 UTSW Arhgef26 0.186 R8039 G1 225.01 N 3 62339930 T145N C A missense Het probably benign 0.323 phenotype 01/23/2020
12 618407 UTSW Art1 0.000 R8039 G1 225.01 N 7 102106845 Q81L A T missense Het probably benign 0.002 phenotype 01/23/2020
13 618374 UTSW Astl 0.115 R8039 G1 225.01 N 2 127343983 S71C A T missense Het probably damaging 1.000 phenotype 01/23/2020
14 618409 UTSW Atp2a1 1.000 R8039 G1 225.01 N 7 126448805 I611T A G missense Het probably damaging 0.994 phenotype 01/23/2020
15 618422 UTSW Cacna2d2 0.775 R8039 G1 225.01 N 9 107527433 V1139D T A missense Het possibly damaging 0.915 phenotype 01/23/2020
16 618364 UTSW Chst10 0.309 R8039 G1 225.01 N 1 38866031 K198* T A nonsense Het probably null phenotype 01/23/2020
17 618436 UTSW Ckmt2 0.261 R8039 G1 225.01 N 13 91863312 H60Y G A missense Het possibly damaging 0.936 phenotype 01/23/2020
18 618408 UTSW Coq7 1.000 R8039 G1 225.01 N 7 118533246 S2R G C missense Het possibly damaging 0.931 phenotype 01/23/2020
19 618363 UTSW Cspp1 0.292 R8039 G1 213.01 N 1 10113013 D814E T A missense Het probably benign 0.023 phenotype 01/23/2020
20 618448 UTSW Cyp2c54 0.081 R8039 G1 217.47 N 19 40073732 CCTCTTTCATAGCTCT CCTCT frame shift Het probably null 01/23/2020
21 618447 UTSW Daam2 0.000 R8039 G1 225.01 N 17 49464538 G860V C A missense Het probably damaging 1.000 Daam1 conditional KO increases the severity of the heart phenotype (abnormal ventricular morphology and pressure) of the Daam1 single KO. [provided by MGI curators] (source: MGI)">phenotype 01/23/2020
22 618434 UTSW Ecm2 0.145 R8039 G1 225.01 N 13 49514850 I10F A T missense Het probably benign 0.000 phenotype 01/23/2020
23 618375 UTSW Epb41l1 0.000 R8039 G1 225.01 N 2 156506412 D312V A T missense Het probably damaging 0.985 phenotype 01/23/2020
24 618440 UTSW Epsti1 0.066 R8039 G1 225.01 N 14 77931301 R126H G A missense Het probably damaging 0.957 phenotype 01/23/2020
25 618401 UTSW Erc1 1.000 R8039 G1 225.01 N 6 119773665 Y367* A T nonsense Het probably null phenotype 01/23/2020
26 618433 UTSW Erh 0.930 R8039 G1 225.01 N 12 80637578 R42W T A missense Het probably damaging 0.995 01/23/2020
27 618439 UTSW Fam124a 0.066 R8039 G1 225.01 N 14 62605876 Q278* C T nonsense Het probably null 01/23/2020
28 618410 UTSW Fam155a 0.175 R8039 G1 225.01 N 8 9207892 T419A T C missense Het probably benign 0.027 01/23/2020
29 618373 UTSW Fbxo3 0.506 R8039 G1 225.01 N 2 104054941 L385Q T A missense Het probably damaging 0.995 phenotype 01/23/2020
30 618417 UTSW Fbxo31 0.000 R8039 G1 225.01 N 8 121559055 T219S T A missense Het probably damaging 0.998 phenotype 01/23/2020
31 618381 UTSW Fstl5 0.099 R8039 G1 225.01 N 3 76648418 V534G T G missense Het possibly damaging 0.693 01/23/2020
32 618427 UTSW Gatsl3 0.000 R8039 G1 225.01 N 11 4221639 A288S G T missense Het probably damaging 0.991 01/23/2020
33 618384 UTSW Gbp2b 0.000 R8039 G1 225.01 N 3 142618164 I577F A T missense Het probably benign 0.024 phenotype 01/23/2020
34 618396 UTSW Gbp8 0.075 R8039 G1 225.01 N 5 105050917 L44* A T nonsense Het probably null 01/23/2020
35 618428 UTSW Gck 1.000 R8039 G1 225.01 N 11 5910301 A114T C T missense Het probably benign 0.121 phenotype 01/23/2020
36 618414 UTSW Gm16486 0.163 R8039 G1 225.01 N 8 70710906 V916A T C missense Het probably benign 0.092 01/23/2020
37 618397 UTSW Gtf2i 1.000 R8039 G1 225.01 N 5 134255834 V537A A G missense Het possibly damaging 0.947 phenotype 01/23/2020
38 618415 UTSW Iqcm 0.060 R8039 G1 225.01 N 8 75763105 H400Q C A missense Het probably damaging 0.998 01/23/2020
39 618400 UTSW Itpr1 0.809 R8039 G1 225.01 N 6 108386628 L737P T C missense Het probably damaging 1.000 phenotype 01/23/2020
40 618395 UTSW Jakmip1 0.740 R8039 G1 225.01 N 5 37100772 E254G A G missense Het probably damaging 0.999 phenotype 01/23/2020
41 618423 UTSW Kif15 0.000 R8039 G1 225.01 N 9 123007425 R1095W A T missense Het possibly damaging 0.822 01/23/2020
42 618367 UTSW Klhdc8a 0.067 R8039 G1 225.01 N 1 132303108 R237Q G A missense Het probably benign 0.439 phenotype 01/23/2020
43 618441 UTSW Klhl38 0.085 R8039 G1 225.01 N 15 58322862 E157G T C missense Het probably benign 0.296 01/23/2020
44 618403 UTSW Klrk1 0.073 R8039 G1 225.01 N 6 129612823 N221I T A missense Het probably benign 0.018 phenotype 01/23/2020
45 618386 UTSW Lhx8 0.289 R8039 G1 225.01 N 3 154306939 H345Q A T missense Het probably damaging 0.977 phenotype 01/23/2020
46 618424 UTSW Lims1 1.000 R8039 G1 225.01 N 10 58409672 N174K T A missense Het probably benign 0.029 phenotype 01/23/2020
47 618372 UTSW Madd 1.000 R8039 G1 225.01 N 2 91167061 Q754L T A missense Het probably benign 0.173 phenotype 01/23/2020
48 618413 UTSW Mau2 1.000 R8039 G1 225.01 N 8 70019790 D581G T C missense Het probably damaging 0.962 phenotype 01/23/2020
49 618385 UTSW Miga1 0.000 R8039 G1 225.01 N 3 152276756 I561N A T missense Het probably benign 0.152 01/23/2020
50 618418 UTSW Mmp1a 0.278 R8039 G1 214.46 N 9 7465083 TG TGG makesense Het probably null phenotype 01/23/2020
51 618389 UTSW Mob3c 0.138 R8039 G1 212.01 N 4 115831687 V139A T C missense Het probably benign 0.002 phenotype 01/23/2020
52 618392 UTSW Nadk 0.926 R8039 G1 225.01 N 4 155577067 D17Y G T missense Het probably benign 0.057 phenotype 01/23/2020
53 618402 UTSW Ncapd2 0.966 R8039 G1 225.01 N 6 125181026 V380I C T missense Het probably damaging 0.983 01/23/2020
54 618382 UTSW Nes 0.489 R8039 G1 225.01 N 3 87977008 R858K G A missense Het probably benign 0.001 phenotype 01/23/2020
55 618421 UTSW Nphp3 1.000 R8039 G1 225.01 N 9 104031963 S791P T C missense Het probably benign 0.000 phenotype 01/23/2020
56 618399 UTSW Nup210 0.000 R8039 G1 225.01 N 6 91070233 T496A T C missense Het probably benign 0.093 phenotype 01/23/2020
57 618378 UTSW Ogfr 0.503 R8039 G1 121.46 N 2 180595266 GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG unclassified Het probably benign phenotype 01/23/2020
58 618371 UTSW Olfr1186 0.066 R8039 G1 225.01 N 2 88525871 T96I C T missense Het probably benign 0.066 phenotype 01/23/2020
59 618368 UTSW Olfr220 0.070 R8039 G1 225.01 N 1 174449596 S324R T A missense Het unknown 0.066 phenotype 01/23/2020
60 618419 UTSW Olfr914 0.057 R8039 G1 225.01 N 9 38607389 M308K T A missense Het probably benign 0.000 phenotype 01/23/2020
61 618383 UTSW Ovgp1 0.000 R8039 G1 225.01 N 3 105976023 S105T T A missense Het probably benign 0.264 phenotype 01/23/2020
62 618425 UTSW Pbld2 0.000 R8039 G1 225.01 N 10 63047992 C79S T A missense Het probably damaging 1.000 01/23/2020
63 618391 UTSW Pik3cd 0.954 R8039 G1 225.01 N 4 149659866 M143L T A missense Het possibly damaging 0.909 phenotype 01/23/2020
64 618412 UTSW Plat 0.000 R8039 G1 225.01 N 8 22772232 G91W G T missense Het probably damaging 1.000 0.881 phenotype 01/23/2020
65 618394 UTSW Poln 0.000 R8039 G1 225.01 N 5 34122672 V282A A G missense Het probably benign 0.159 0.090 phenotype 01/23/2020
66 618446 UTSW Ppp1r11 0.878 R8039 G1 225.01 N 17 36951446 T21A T C missense Het probably damaging 0.966 phenotype 01/23/2020
67 618429 UTSW Prpf8 0.958 R8039 G1 225.01 N 11 75502542 I1664N T A missense Het possibly damaging 0.953 phenotype 01/23/2020
68 618430 UTSW Prr29 0.000 R8039 G1 225.01 N 11 106376912 A161V C T missense Het probably benign 0.100 01/23/2020
69 618411 UTSW Rasa3 1.000 R8039 G1 225.01 N 8 13588931 D292G T C missense Het probably damaging 0.999 phenotype 01/23/2020
70 618366 UTSW Rnf25 0.000 R8039 G1 225.01 N 1 74593964 T411A T C missense Het probably damaging 0.977 phenotype 01/23/2020
71 618388 UTSW Rraga 1.000 R8039 G1 225.01 N 4 86575980 T21I C T missense Het probably damaging 0.998 phenotype 01/23/2020
72 618438 UTSW Setdb2 0.653 R8039 G1 225.01 N 14 59402375 Y673F T A missense Het probably damaging 1.000 phenotype 01/23/2020
73 618426 UTSW Sf3a1 1.000 R8039 G1 225.01 N 11 4167787 T183I C T missense Het probably damaging 1.000 phenotype 01/23/2020
74 618442 UTSW Shank3 0.281 R8039 G1 225.01 N 15 89505439 H413L A T missense Het probably damaging 1.000 phenotype 01/23/2020
75 618437 UTSW Slc30a5 0.408 R8039 G1 225.01 N 13 100813681 A G critical splice donor site 2 bp Het probably null phenotype 01/23/2020
76 618435 UTSW Slc6a18 0.000 R8039 G1 225.01 N 13 73665626 S523G T C missense Het probably benign 0.390 phenotype 01/23/2020
77 618387 UTSW Spaca1 0.000 R8039 G1 225.01 N 4 34044207 V96I C T missense Het probably damaging 0.993 phenotype 01/23/2020
78 618377 UTSW Sycp2 0.000 R8039 G1 225.01 N 2 178374585 A695T C T missense Het probably benign 0.049 phenotype 01/23/2020
79 618398 UTSW Tnrc18 0.671 R8039 G1 225.01 N 5 142732052 G2216C C A missense Het unknown 01/23/2020
80 618365 UTSW Trak2 0.000 R8039 G1 225.01 N 1 58946288 N17S T C missense Het probably benign 0.164 01/23/2020
81 618370 UTSW Ttn 1.000 R8039 G1 225.01 N 2 76878432 N8792I T A missense Het unknown phenotype 01/23/2020
82 618404 UTSW Ttyh1 1.000 R8039 G1 225.01 N 7 4122541 V64A T C missense Het probably benign 0.009 phenotype 01/23/2020
83 618416 UTSW Usb1 0.139 R8039 G1 225.01 N 8 95333413 S50R T A missense Het probably damaging 0.995 phenotype 01/23/2020
84 618369 UTSW Ush2a 0.436 R8039 G1 225.01 N 1 188957373 I5044N T A missense Het probably damaging 0.998 phenotype 01/23/2020
85 618405 UTSW Vmn1r84 0.061 R8039 G1 225.01 N 7 12362008 F253I A T missense Het possibly damaging 0.667 01/23/2020
86 618444 UTSW Vmn2r99 0.117 R8039 G1 225.01 N 17 19380040 I442T T C missense Het probably benign 0.004 01/23/2020
87 618449 UTSW Vsig1 0.079 R8039 G1 222 N X 140933126 H232Y C T missense Het probably benign 0.015 phenotype 01/23/2020
[records 1 to 87 of 87]