Incidental Mutations

62 incidental mutations are currently displayed, and affect 62 genes.
10 are Possibly Damaging.
23 are Probably Damaging.
21 are Probably Benign.
5 are Probably Null.
1 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 62 of 62] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 629098 UTSW 1700093K21Rik 0.072 R8077 G1 225.01 Y 11 23517237 V132E A T missense Het probably benign 0.000 phenotype 06/30/2020
2 629090 UTSW 4930563M21Rik 0.076 R8077 G1 225.01 Y 9 55987966 V315M C T missense Het probably damaging 0.974 06/30/2020
3 629069 UTSW 9430007A20Rik 0.055 R8077 G1 174.01 Y 4 144528556 I182T T C missense Het probably benign 0.202 06/30/2020
4 629070 UTSW Alb 0.247 R8077 G1 192.01 Y 5 90467355 R242P G C missense Het probably damaging 0.996 0.857 phenotype 06/30/2020
5 629088 UTSW Amotl1 0.132 R8077 G1 225.01 Y 9 14550502 V805D A T missense Het probably damaging 1.000 0.097 phenotype 06/30/2020
6 629103 UTSW Arhgef3 0.152 R8077 G1 184.01 Y 14 27385924 L179P T C missense Het probably damaging 1.000 phenotype 06/30/2020
7 629096 UTSW Atp8b3 0.091 R8077 G1 225.01 Y 10 80531024 L247F G A missense Het possibly damaging 0.955 phenotype 06/30/2020
8 629110 UTSW Ccdc191 0.166 R8077 G1 206.01 Y 16 43915605 T C critical splice donor site 2 bp Het probably null 0.950 06/30/2020
9 629092 UTSW Celsr3 1.000 R8077 G1 225.01 Y 9 108828331 H671R A G missense Het probably benign 0.152 phenotype 06/30/2020
10 629076 UTSW Cemip 0.086 R8077 G1 184.01 Y 7 84003408 C A start gained Het probably benign phenotype 06/30/2020
11 629083 UTSW Cfap97 0.074 R8077 G1 225.01 Y 8 46170445 V291F G T missense Het possibly damaging 0.861 06/30/2020
12 629064 UTSW Clca2 0.000 R8077 G1 225.01 Y 3 145071527 V861A A G missense Het possibly damaging 0.565 phenotype 06/30/2020
13 629082 UTSW Cln8 0.284 R8077 G1 225.01 Y 8 14894950 D88V A T missense Het probably damaging 1.000 0.777 phenotype 06/30/2020
14 629094 UTSW Col18a1 0.000 R8077 G1 225.01 Y 10 77080851 G330V C A missense Het unknown phenotype 06/30/2020
15 629105 UTSW Dis3 1.000 R8077 G1 225.01 Y 14 99090035 R344Q C T missense Het probably benign 0.029 06/30/2020
16 629101 UTSW Esyt2 0.000 R8077 G1 225.01 Y 12 116342228 S359R T A missense Het possibly damaging 0.540 0.329 phenotype 06/30/2020
17 629072 UTSW Fbxo41 0.273 R8077 G1 225.01 Y 6 85473229 L844Q A T missense Het probably damaging 0.980 phenotype 06/30/2020
18 629054 UTSW Fn1 1.000 R8077 G1 225.01 Y 1 71612602 T1372M G A missense Het probably damaging 0.999 phenotype 06/30/2020
19 629063 UTSW Gbp5 0.000 R8077 G1 225.01 Y 3 142507739 R472H G A missense Het probably benign 0.007 phenotype 06/30/2020
20 629074 UTSW Gm156 0.052 R8077 G1 225.01 Y 6 129766695 Y209H A G missense Het probably benign 0.009 06/30/2020
21 629087 UTSW Gm21964 0.174 R8077 G1 225.01 Y 8 110110103 T207M C T missense Het probably damaging 0.998 06/30/2020
22 629079 UTSW Gm4559 0.127 R8077 G1 225.01 N 7 142273816 R183K C T missense Het unknown 06/30/2020
23 629095 UTSW Gm9507 R8077 G1 225.01 N 10 77811770 E25V T A missense Het unknown 06/30/2020
24 629112 UTSW Gm9573 0.093 R8077 G1 115.47 N 17 35619736 TCAGTGGTGGTCAGGATGGGGGTAGAGCCTGAGCCACTCCTGGATGCAGTGGTGGTCAGG TCAGTGGTGGTCAGG intron Het probably benign 06/30/2020
25 629109 UTSW Golgb1 0.842 R8077 G1 225.01 Y 16 36918633 I2486V A G missense Het probably damaging 0.992 0.118 phenotype 06/30/2020
26 629080 UTSW Ifitm10 0.063 R8077 G1 225.01 Y 7 142370967 V45D A T missense Het probably damaging 0.998 06/30/2020
27 629062 UTSW Ift80 0.205 R8077 G1 225.01 Y 3 68916145 Y595H A G missense Het probably benign 0.011 phenotype 06/30/2020
28 629059 UTSW Itga8 0.765 R8077 G1 225.01 Y 2 12242433 V326I C T missense Het probably benign 0.095 phenotype 06/30/2020
29 629056 UTSW Kif14 0.920 R8077 G1 204.01 Y 1 136471448 H449L A T missense Het possibly damaging 0.867 phenotype 06/30/2020
30 629067 UTSW Ldlrad1 0.000 R8077 G1 225.01 Y 4 107209491 A8T G A missense Het probably benign 0.001 0.085 06/30/2020
31 629071 UTSW Lrrc8b 0.194 R8077 G1 225.01 Y 5 105480017 S76R C A missense Het possibly damaging 0.478 06/30/2020
32 629073 UTSW Lrrn1 0.472 R8077 G1 225.01 Y 6 107568822 L527P T C missense Het probably damaging 0.990 phenotype 06/30/2020
33 629111 UTSW Luc7l 0.230 R8077 G1 225.01 Y 17 26255073 V35A T C missense Het probably damaging 1.000 phenotype 06/30/2020
34 629068 UTSW Luzp1 0.879 R8077 G1 225.01 Y 4 136543091 V875G T G missense Het probably damaging 1.000 phenotype 06/30/2020
35 629081 UTSW Mcf2l 0.000 R8077 G1 225.01 Y 8 12998494 G T critical splice donor site 1 bp Het probably null phenotype 06/30/2020
36 629065 UTSW Mcoln2 0.084 R8077 G1 225.01 Y 3 146190414 M497T T C missense Het probably damaging 0.995 phenotype 06/30/2020
37 629075 UTSW Mrgprb4 0.000 R8077 G1 225.01 Y 7 48198455 S242T A T missense Het probably benign 0.001 phenotype 06/30/2020
38 629106 UTSW Nipbl 0.968 R8077 G1 225.01 Y 15 8311250 R1995S T A missense Het possibly damaging 0.487 0.525 phenotype 06/30/2020
39 643163 UTSW Nup35 1.000 R8077 G1 225.01 Y 2 80638936 A G splice site 4 bp Het probably null phenotype 08/07/2020
40 629099 UTSW Olfr1394 0.050 R8077 G1 225.01 Y 11 49160485 D157G A G missense Het probably damaging 0.998 phenotype 06/30/2020
41 643162 UTSW Olfr420 0.088 R8077 G1 67.01 Y 1 174151845 A G unclassified Het probably benign phenotype 08/07/2020
42 629078 UTSW Olfr45 0.052 R8077 G1 225.01 Y 7 140691133 S76F C T missense Het probably benign 0.159 phenotype 06/30/2020
43 629060 UTSW Prdm12 1.000 R8077 G1 225.01 Y 2 31642304 K109E A G missense Het probably damaging 0.987 06/30/2020
44 629102 UTSW Ptch1 1.000 R8077 G1 225.01 Y 13 63540812 L444Q A T missense Het probably damaging 0.975 phenotype 06/30/2020
45 629089 UTSW Qtrt1 0.334 R8077 G1 225.01 Y 9 21420096 R374* C T nonsense Het probably null 0.976 phenotype 06/30/2020
46 629104 UTSW Rnase11 0.096 R8077 G1 225.01 Y 14 51049941 D52G T C missense Het probably damaging 0.991 06/30/2020
47 629066 UTSW Rps6 0.946 R8077 G1 216.01 Y 4 86855921 S148P A G missense Het probably benign 0.007 0.124 phenotype 06/30/2020
48 629107 UTSW Rrm2b 0.604 R8077 G1 225.01 Y 15 37946800 K86E T C missense Het possibly damaging 0.655 0.833 phenotype 06/30/2020
49 629057 UTSW Sh2d1b2 0.000 R8077 G1 225.01 Y 1 170248173 K59E A G missense Het possibly damaging 0.932 phenotype 06/30/2020
50 629100 UTSW Six6 0.000 R8077 G1 225.01 Y 12 72940326 W91R T A missense Het probably damaging 1.000 phenotype 06/30/2020
51 629061 UTSW Slc23a2 1.000 R8077 G1 225.01 Y 2 132089172 A136S C A missense Het possibly damaging 0.514 phenotype 06/30/2020
52 629086 UTSW Slc9a5 0.116 R8077 G1 225.01 Y 8 105359380 R593H G A missense Het probably damaging 0.997 06/30/2020
53 629108 UTSW Smbd1 0.078 R8077 G1 225.01 Y 16 32810434 M1V T C start codon destroyed Het probably null 0.014 0.976 06/30/2020
54 629085 UTSW Ssbp4 0.804 R8077 G1 225.01 Y 8 70598997 Y239C T C missense Het probably damaging 0.997 06/30/2020
55 629093 UTSW Stox1 0.202 R8077 G1 225.01 Y 10 62665566 E405G T C missense Het probably damaging 0.996 phenotype 06/30/2020
56 629084 UTSW Tmem192 0.102 R8077 G1 225.01 Y 8 64965544 I194V A G missense Het probably benign 0.013 phenotype 06/30/2020
57 629097 UTSW Tns3 0.353 R8077 G1 225.01 Y 11 8445667 C1246S A T missense Het probably damaging 1.000 phenotype 06/30/2020
58 629055 UTSW Ugt1a6a 0.193 R8077 G1 225.01 Y 1 88138853 Q127L A T missense Het probably benign 0.311 06/30/2020
59 629058 UTSW Ush2a 0.605 R8077 G1 225.01 Y 1 188542828 I1833V A G missense Het probably benign 0.008 phenotype 06/30/2020
60 629077 UTSW Vmn2r66 0.175 R8077 G1 225.01 Y 7 85006885 Y308N A T missense Het probably benign 0.000 06/30/2020
61 629113 UTSW Vti1a 0.000 R8077 G1 225.01 N 19 55576485 L191R T G missense Het probably benign 0.074 phenotype 06/30/2020
62 629091 UTSW Zbtb38 0.573 R8077 G1 225.01 Y 9 96688100 N310K A T missense Het probably benign 0.000 phenotype 06/30/2020
[records 1 to 62 of 62]