Incidental Mutations

69 incidental mutations are currently displayed, and affect 69 genes.
13 are Possibly Damaging.
23 are Probably Damaging.
22 are Probably Benign.
9 are Probably Null.
3 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 69 of 69] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 630819 UTSW 0610010F05Rik 0.122 R8110 G1 225.01 Y 11 23576764 (GRCm38) T696N G T missense Het probably benign 0.000 2020-06-30
2 630779 UTSW Ankrd45 0.000 R8110 G1 221.01 Y 1 161151319 (GRCm38) T C critical splice donor site 2 bp Het probably null 2020-06-30
3 630827 UTSW Appl1 0.188 R8110 G1 225.01 Y 14 26927794 (GRCm38) G592* C A nonsense Het probably null phenotype 2020-06-30
4 630790 UTSW Arfgef2 0.340 R8110 G1 225.01 Y 2 166878544 (GRCm38) M1501K T A missense Het probably benign 0.010 phenotype 2020-06-30
5 630787 UTSW Calcrl 1.000 R8110 G1 225.01 Y 2 84339339 (GRCm38) A333T C T missense Het probably damaging 1.000 phenotype 2020-06-30
6 630836 UTSW Cd200r3 0.089 R8110 G1 207.01 Y 16 44951472 (GRCm38) I33N T A missense Het probably benign 0.415 2020-06-30
7 630806 UTSW Ceacam15 0.070 R8110 G1 225.01 Y 7 16673409 (GRCm38) L61P A G missense Het probably benign 0.005 2020-06-30
8 630796 UTSW Cfap69 0.000 R8110 G1 225.01 Y 5 5582515 (GRCm38) H827L T A missense Het possibly damaging 0.786 phenotype 2020-06-30
9 630832 UTSW Csmd3 0.000 R8110 G1 225.01 Y 15 47644270 (GRCm38) E2780V T A missense Het probably damaging 0.997 0.076 2020-06-30
10 630794 UTSW Cyp2u1 0.154 R8110 G1 225.01 Y 3 131293654 (GRCm38) T426I G A missense Het probably damaging 0.999 phenotype 2020-06-30
11 630802 UTSW Eefsec 0.895 R8110 G1 225.01 Y 6 88376330 (GRCm38) I119S A C missense Het probably damaging 1.000 0.960 2020-06-30
12 630815 UTSW Fem1b 0.409 R8110 G1 225.01 Y 9 62796268 (GRCm38) N570S T C missense Het probably damaging 0.996 phenotype 2020-06-30
13 630780 UTSW Fmo9 0.059 R8110 G1 225.01 Y 1 166663526 (GRCm38) M461T A G missense Het probably benign 0.032 2020-06-30
14 630797 UTSW Fryl 0.710 R8110 G1 225.01 Y 5 73133277 (GRCm38) Y95H A G missense Het probably benign 0.100 phenotype 2020-06-30
15 630786 UTSW Fsip2 0.076 R8110 G1 209.01 Y 2 82958673 (GRCm38) I346T T C missense Het probably benign 0.001 phenotype 2020-06-30
16 630811 UTSW Fto 0.000 R8110 G1 200.01 Y 8 91485190 (GRCm38) F381S T C missense Het probably damaging 1.000 phenotype 2020-06-30
17 630840 UTSW Gabbr1 0.545 R8110 G1 225.01 Y 17 37048583 (GRCm38) S150T G C missense Het probably benign 0.104 phenotype 2020-06-30
18 630798 UTSW Galnt9 0.071 R8110 G1 225.01 Y 5 110615473 (GRCm38) W448L G T missense Het probably damaging 0.997 0.911 phenotype 2020-06-30
19 630824 UTSW Gcnt2 0.071 R8110 G1 110.01 Y 13 40917722 (GRCm38) G T start gained Het probably benign phenotype 2020-06-30
20 630789 UTSW Gm10800 0.285 R8110 G1 214.46 N 2 98667016 (GRCm38) CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA CAAGAAAACTGAAAATCA frame shift Het probably null 2020-06-30
21 643807 UTSW Gm17727 0.051 R8110 G1 225.01 Y 9 35778033 (GRCm38) *84W T C makesense Het probably null 2020-08-19
22 630803 UTSW Gm8882 0.079 R8110 G1 225.01 N 6 132361568 (GRCm38) G229D C T missense Het unknown 2020-06-30
23 630801 UTSW Gmcl1 0.551 R8110 G1 225.01 Y 6 86721426 (GRCm38) A163E G T missense Het probably damaging 0.999 0.527 phenotype 2020-06-30
24 630799 UTSW Hectd4 0.411 R8110 G1 225.01 Y 5 121332949 (GRCm38) Y2633C A G missense Het possibly damaging 0.956 2020-06-30
25 630812 UTSW Hsd11b2 1.000 R8110 G1 225.01 Y 8 105522634 (GRCm38) I214V A G missense Het probably damaging 0.976 phenotype 2020-06-30
26 630844 UTSW Hspa12a 0.152 R8110 G1 210.01 Y 19 58821013 (GRCm38) E217V T A missense Het possibly damaging 0.858 2020-06-30
27 630782 UTSW Itih2 0.109 R8110 G1 223.01 Y 2 10097137 (GRCm38) F845L A G missense Het probably damaging 0.981 phenotype 2020-06-30
28 630793 UTSW Kcnn3 0.309 R8110 G1 225.01 Y 3 89661233 (GRCm38) L606H T A missense Het probably damaging 0.994 phenotype 2020-06-30
29 630835 UTSW Krt6b 0.147 R8110 G1 225.01 Y 15 101680142 (GRCm38) R28C G A missense Het probably damaging 0.962 2020-06-30
30 630817 UTSW Lama2 0.331 R8110 G1 225.01 Y 10 26990870 (GRCm38) D2876V T A missense Het probably damaging 1.000 0.598 phenotype 2020-06-30
31 630830 UTSW Lmbrd2 0.255 R8110 G1 225.01 Y 15 9175192 (GRCm38) S397P T C missense Het probably damaging 1.000 2020-06-30
32 630834 UTSW Lmf2 0.107 R8110 G1 203.01 Y 15 89352358 (GRCm38) C T critical splice donor site 1 bp Het probably null 2020-06-30
33 630784 UTSW Lrp2 1.000 R8110 G1 225.01 Y 2 69506453 (GRCm38) I1325T A G missense Het probably benign 0.000 phenotype 2020-06-30
34 630823 UTSW Ltbp2 0.721 R8110 G1 225.01 Y 12 84803902 (GRCm38) C879* A T nonsense Het probably null phenotype 2020-06-30
35 630826 UTSW Map3k1 0.886 R8110 G1 203.01 Y 13 111755313 (GRCm38) V1136A A G missense Het probably damaging 0.983 phenotype 2020-06-30
36 630828 UTSW Mettl3 1.000 R8110 G1 197.01 Y 14 52300252 (GRCm38) H84N G T missense Het probably benign 0.023 phenotype 2020-06-30
37 643808 UTSW Mia2 0.948 R8110 G1 225.01 Y 12 59109087 (GRCm38) A G splice site Het probably null phenotype 2020-08-19
38 630816 UTSW Mlip 0.108 R8110 G1 225.01 Y 9 77239579 (GRCm38) T92K G T missense Het probably damaging 0.972 phenotype 2020-06-30
39 630829 UTSW Nalcn 1.000 R8110 G1 225.01 Y 14 123464701 (GRCm38) Y466F T A missense Het probably benign 0.003 phenotype 2020-06-30
40 630808 UTSW Nav2 0.633 R8110 G1 146.01 Y 7 49551950 (GRCm38) L235* T A nonsense Het probably null phenotype 2020-06-30
41 630795 UTSW Nbn 1.000 R8110 G1 225.01 Y 4 15981588 (GRCm38) V560A T C missense Het probably benign 0.023 phenotype 2020-06-30
42 630818 UTSW Ncln 0.942 R8110 G1 225.01 Y 10 81493153 (GRCm38) Y144N A T missense Het possibly damaging 0.940 0.936 2020-06-30
43 630785 UTSW Nfe2l2 0.848 R8110 G1 225.01 Y 2 75679421 (GRCm38) D18E A C missense Het probably benign 0.025 phenotype 2020-06-30
44 630841 UTSW Olfr102 0.080 R8110 G1 225.01 N 17 37313713 (GRCm38) F224L A G missense Het probably benign 0.001 phenotype 2020-06-30
45 630788 UTSW Olfr1131 0.061 R8110 G1 225.01 Y 2 87628607 (GRCm38) I48T T C missense Het possibly damaging 0.753 0.332 phenotype 2020-06-30
46 630783 UTSW Olfr356 0.058 R8110 G1 225.01 Y 2 36937709 (GRCm38) C197R T C missense Het possibly damaging 0.797 phenotype 2020-06-30
47 630781 UTSW Olfr432 0.062 R8110 G1 225.01 Y 1 174050525 (GRCm38) A51T G A missense Het probably benign 0.014 phenotype 2020-06-30
48 630821 UTSW Otop3 0.082 R8110 G1 225.01 Y 11 115339395 (GRCm38) M33L A T missense Het probably benign 0.000 2020-06-30
49 630831 UTSW Pdzd2 0.173 R8110 G1 225.01 Y 15 12373506 (GRCm38) S2181L G A missense Het probably benign 0.010 phenotype 2020-06-30
50 630800 UTSW Phf14 1.000 R8110 G1 225.01 Y 6 11953423 (GRCm38) I387T T C missense Het possibly damaging 0.912 0.342 phenotype 2020-06-30
51 630837 UTSW Prdm9 0.370 R8110 G1 209.01 Y 17 15554698 (GRCm38) N318Y T A missense Het probably damaging 0.998 phenotype 2020-06-30
52 630820 UTSW Proca1 0.064 R8110 G1 225.01 Y 11 78204911 (GRCm38) D123G A G missense Het probably damaging 0.991 2020-06-30
53 630843 UTSW Prune2 0.000 R8110 G1 225.01 Y 19 17120719 (GRCm38) G1196S G A missense Het probably benign 0.216 phenotype 2020-06-30
54 630810 UTSW Psd3 0.092 R8110 G1 225.01 Y 8 68121056 (GRCm38) S158C T A missense Het probably damaging 0.996 2020-06-30
55 630838 UTSW Rps18 0.000 R8110 G1 225.01 Y 17 33955136 (GRCm38) V15A A G missense Het probably benign 0.446 phenotype 2020-06-30
56 630833 UTSW Sharpin 0.381 R8110 G1 225.01 Y 15 76347765 (GRCm38) R271L C A missense Het possibly damaging 0.795 phenotype 2020-06-30
57 630825 UTSW Smad5 1.000 R8110 G1 225.01 Y 13 56723888 (GRCm38) Q99K C A missense Het probably damaging 0.999 phenotype 2020-06-30
58 630804 UTSW Sox5 1.000 R8110 G1 225.01 Y 6 144116474 (GRCm38) M151V T C missense Het possibly damaging 0.915 phenotype 2020-06-30
59 630778 UTSW Sphkap 0.070 R8110 G1 225.01 Y 1 83278771 (GRCm38) F419Y A T missense Het possibly damaging 0.820 2020-06-30
60 630813 UTSW Tbx20 1.000 R8110 G1 225.01 Y 9 24725525 (GRCm38) Y422F T A missense Het probably damaging 0.995 phenotype 2020-06-30
61 630842 UTSW Tcirg1 0.828 R8110 G1 225.01 Y 19 3899099 (GRCm38) F397V A C missense Het probably damaging 0.999 0.963 phenotype 2020-06-30
62 630809 UTSW Tex36 0.048 R8110 G1 194.01 Y 7 133595283 (GRCm38) S35F G A missense Het possibly damaging 0.911 2020-06-30
63 630822 UTSW Tsen54 0.960 R8110 G1 225.01 Y 11 115814934 (GRCm38) A26S G T missense Het unknown phenotype 2020-06-30
64 643806 UTSW Usp50 1.000 R8110 G1 107.01 Y 2 126780330 (GRCm38) T A splice site 58 bp Het probably null 2020-08-19
65 630791 UTSW Vmn2r5 0.110 R8110 G1 225.01 Y 3 64491288 (GRCm38) F757I A T missense Het probably benign 0.004 2020-06-30
66 630792 UTSW Zbbx 0.050 R8110 G1 225.01 Y 3 75155442 (GRCm38) T3A T C missense Het possibly damaging 0.581 2020-06-30
67 630805 UTSW Zfp28 0.115 R8110 G1 225.01 Y 7 6389829 (GRCm38) M168K T A missense Het probably benign 0.017 2020-06-30
68 630807 UTSW Zfp568 1.000 R8110 G1 225.01 Y 7 30023126 (GRCm38) G499W G T missense Het probably damaging 1.000 phenotype 2020-06-30
69 643809 UTSW Zfp7 0.000 R8110 G1 60.01 Y 15 76890931 (GRCm38) P391R C G missense Het possibly damaging 0.938 2020-08-19
[records 1 to 69 of 69]