Incidental Mutations

39 incidental mutations are currently displayed, and affect 39 genes.
3 are Possibly Damaging.
15 are Probably Damaging.
15 are Probably Benign.
6 are Probably Null.
2 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 39 of 39] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 632239 UTSW Abca12 1.000 R8136 G1 225.01 Y 1 71248397 (GRCm38) M2462L T A missense Het probably benign 0.147 phenotype 2020-06-30
2 632250 UTSW Aptx 0.000 R8136 G1 217.01 Y 4 40688107 (GRCm38) A G critical splice donor site 2 bp Het probably null phenotype 2020-06-30
3 632248 UTSW Bmpr1b 0.687 R8136 G1 225.01 Y 3 141856382 (GRCm38) I348T A G missense Het probably damaging 1.000 phenotype 2020-06-30
4 643825 UTSW Btnl1 0.000 R8136 G1 92.01 Y 17 34380040 (GRCm38) T A splice site 193 bp Het probably null 2020-08-26
5 632251 UTSW Col27a1 1.000 R8136 G1 225.01 Y 4 63283953 (GRCm38) D960E T A missense Het probably benign 0.058 phenotype 2020-06-30
6 632253 UTSW Crygn 0.065 R8136 G1 225.01 Y 5 24751092 (GRCm38) R172S G T missense Het probably benign 0.006 phenotype 2020-06-30
7 632277 UTSW Cyp26a1 1.000 R8136 G1 225.01 Y 19 37701206 (GRCm38) I450T T C missense Het probably benign 0.001 phenotype 2020-06-30
8 632274 UTSW Emc2 0.915 R8136 G1 225.01 Y 15 43511806 (GRCm38) Y233C A G missense Het probably benign 0.074 2020-06-30
9 632270 UTSW Esyt2 0.000 R8136 G1 225.01 Y 12 116363459 (GRCm38) T549K C A missense Het probably benign 0.000 phenotype 2020-06-30
10 632259 UTSW Fam71e1 0.115 R8136 G1 225.01 Y 7 44500280 (GRCm38) F142L T C missense Het probably damaging 0.987 2020-06-30
11 632244 UTSW Gatm 0.000 R8136 G1 225.01 Y 2 122595537 (GRCm38) D411G T C missense Het probably damaging 1.000 0.967 phenotype 2020-06-30
12 632268 UTSW Gpr65 0.000 R8136 G1 225.01 Y 12 98275156 (GRCm38) Y23H T C missense Het probably damaging 1.000 phenotype 2020-06-30
13 632256 UTSW Itpr1 0.888 R8136 G1 225.01 Y 6 108438360 (GRCm38) R1752G A G missense Het probably benign 0.180 phenotype 2020-06-30
14 632264 UTSW Krtap4-1 0.075 R8136 G1 217.47 N 11 99627834 (GRCm38) GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC small insertion Het probably benign 2020-06-30
15 632240 UTSW Map3k19 0.115 R8136 G1 225.01 Y 1 127823755 (GRCm38) S620A A C missense Het probably damaging 0.992 2020-06-30
16 632262 UTSW Mcm9 0.000 R8136 G1 225.01 Y 10 53611343 (GRCm38) *543Q A G makesense Het probably null phenotype 2020-06-30
17 632252 UTSW Mfsd2a 0.205 R8136 G1 225.01 Y 4 122951867 (GRCm38) C164S A T missense Het probably benign 0.269 phenotype 2020-06-30
18 632269 UTSW Mta1 0.000 R8136 G1 225.01 Y 12 113131678 (GRCm38) R484S C A missense Het probably damaging 1.000 phenotype 2020-06-30
19 632258 UTSW Nlrp9a 0.077 R8136 G1 225.01 Y 7 26557253 (GRCm38) F99V T G missense Het probably benign 0.342 2020-06-30
20 632247 UTSW Notch2 1.000 R8136 G1 225.01 Y 3 98124221 (GRCm38) C1137Y G A missense Het probably damaging 1.000 phenotype 2020-06-30
21 632260 UTSW Olfr575 0.070 R8136 G1 225.01 Y 7 102955241 (GRCm38) M120K A T missense Het probably damaging 0.997 phenotype 2020-06-30
22 632266 UTSW Pcnx 0.000 R8136 G1 225.01 Y 12 81918006 (GRCm38) T316A A G missense Het probably benign 0.000 phenotype 2020-06-30
23 632273 UTSW Phf11a 0.056 R8136 G1 225.01 Y 14 59277569 (GRCm38) V221A A G missense Het probably benign 0.000 2020-06-30
24 632261 UTSW Pigb 0.834 R8136 G1 225.01 Y 9 73022320 (GRCm38) L327P A G missense Het possibly damaging 0.774 phenotype 2020-06-30
25 632272 UTSW Rab3c 0.000 R8136 G1 225.01 Y 13 110181020 (GRCm38) Y110* A T nonsense Het probably null phenotype 2020-06-30
26 632265 UTSW Sdk2 0.087 R8136 G1 225.01 Y 11 113851713 (GRCm38) T790M G A missense Het probably damaging 1.000 phenotype 2020-06-30
27 632275 UTSW Slc22a2 0.000 R8136 G1 214.01 Y 17 12606030 (GRCm38) P260S C T missense Het probably damaging 1.000 phenotype 2020-06-30
28 643824 UTSW Sppl2a 0.067 R8136 G1 225.01 Y 2 126913281 (GRCm38) T C splice site 19 bp Het probably null 0.976 phenotype 2020-08-26
29 632245 UTSW Tmem189 0.000 R8136 G1 225.01 Y 2 167644959 (GRCm38) Y167D A C missense Het probably benign 0.043 0.789 phenotype 2020-06-30
30 632241 UTSW Tnn 0.475 R8136 G1 225.01 Y 1 160107060 (GRCm38) Q1261L T A missense Het probably damaging 0.959 2020-06-30
31 632276 UTSW Treml4 0.069 R8136 G1 225.01 Y 17 48264717 (GRCm38) Y49* C A nonsense Het probably null phenotype 2020-06-30
32 632271 UTSW Ttc37 0.547 R8136 G1 225.01 Y 13 76113103 (GRCm38) K131R A G missense Het probably benign 0.003 phenotype 2020-06-30
33 632242 UTSW Ubr3 1.000 R8136 G1 225.01 Y 2 70021179 (GRCm38) I1827T T C missense Het probably damaging 0.996 0.544 phenotype 2020-06-30
34 632267 UTSW Vrtn 0.097 R8136 G1 225.01 Y 12 84650035 (GRCm38) R520C C T missense Het probably damaging 1.000 0.105 2020-06-30
35 632243 UTSW Wipf1 0.157 R8136 G1 210.01 Y 2 73437535 (GRCm38) P173L G A missense Het possibly damaging 0.670 0.074 phenotype 2020-06-30
36 632249 UTSW Wls 1.000 R8136 G1 225.01 Y 3 159873124 (GRCm38) Q108K C A missense Het probably damaging 0.999 phenotype 2020-06-30
37 632246 UTSW Zfp217 0.921 R8136 G1 225.01 Y 2 170119651 (GRCm38) S252F G A missense Het possibly damaging 0.820 0.093 2020-06-30
38 632263 UTSW Zfp39 0.177 R8136 G1 225.01 Y 11 58891402 (GRCm38) V178D A T missense Het probably damaging 0.992 phenotype 2020-06-30
39 632255 UTSW Zfp777 0.873 R8136 G1 225.01 Y 6 48044625 (GRCm38) R21L C A missense Het probably benign 0.250 2020-06-30
[records 1 to 39 of 39]