Incidental Mutations

53 incidental mutations are currently displayed, and affect 53 genes.
7 are Possibly Damaging.
20 are Probably Damaging.
18 are Probably Benign.
6 are Probably Null.
2 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 53 of 53] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 635358 UTSW A230046K03Rik 0.951 R8194 G1 225.01 Y 10 83580299 I818V A G missense Het possibly damaging 0.511 07/13/2020
2 635364 UTSW Arid4a 0.000 R8194 G1 225.01 Y 12 71060115 Y320* T A nonsense Het probably null 0.976 phenotype 07/13/2020
3 635332 UTSW Ash1l 1.000 R8194 G1 225.01 Y 3 89052755 C2265S T A missense Het probably damaging 1.000 phenotype 07/13/2020
4 652030 UTSW Atg4b 0.102 R8194 G1 225.01 Y 1 93785972 C55* T A nonsense Het probably null phenotype 09/23/2020
5 635325 UTSW Cacna1s 1.000 R8194 G1 225.01 Y 1 136077692 N405I A T missense Het probably benign 0.333 phenotype 07/13/2020
6 635374 UTSW Capn11 0.000 R8194 G1 225.01 Y 17 45633399 D526E A T missense Het probably damaging 0.962 phenotype 07/13/2020
7 635371 UTSW Ccdc188 0.077 R8194 G1 225.01 Y 16 18218380 R71G A G missense Het probably benign 0.000 07/13/2020
8 635367 UTSW Ccser2 0.241 R8194 G1 225.01 Y 14 36896263 R772W G A missense Het probably damaging 0.999 07/13/2020
9 635327 UTSW Cenpf 0.759 R8194 G1 225.01 Y 1 189682403 E172D T A missense Het probably benign 0.063 phenotype 07/13/2020
10 635336 UTSW Cep85 0.939 R8194 G1 225.01 Y 4 134134089 M627V T C missense Het probably null 0.001 phenotype 07/13/2020
11 635373 UTSW Chd1 0.000 R8194 G1 121.01 Y 17 17374475 G A start gained Het probably benign phenotype 07/13/2020
12 635326 UTSW Cnst 0.139 R8194 G1 225.01 Y 1 179610194 H441R A G missense Het probably benign 0.001 phenotype 07/13/2020
13 635370 UTSW Cyp2d11 0.084 R8194 G1 225.01 Y 15 82390437 T313N G T missense Het probably damaging 0.999 07/13/2020
14 635341 UTSW Cyp2g1 0.000 R8194 G1 225.01 Y 7 26814734 N255S A G missense Het possibly damaging 0.886 phenotype 07/13/2020
15 635368 UTSW Dnah5 0.641 R8194 G1 225.01 Y 15 28453268 D4395G A G missense Het probably damaging 0.991 phenotype 07/13/2020
16 635369 UTSW Fam83h 0.454 R8194 G1 209.46 Y 15 76002775 ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT small deletion Het probably benign phenotype 07/13/2020
17 635330 UTSW Fcnb 0.000 R8194 G1 225.01 Y 2 28078318 S209N C T missense Het possibly damaging 0.655 0.171 phenotype 07/13/2020
18 635329 UTSW Gpsm1 0.000 R8194 G1 173.47 Y 2 26327352 CT CTT frame shift Het probably null 0.976 phenotype 07/13/2020
19 635355 UTSW Lama4 1.000 R8194 G1 225.01 Y 10 39078720 S1090G A G missense Het probably damaging 0.991 phenotype 07/13/2020
20 635328 UTSW Malrd1 0.080 R8194 G1 225.01 Y 2 15925120 D1479G A G missense Het unknown 07/13/2020
21 635343 UTSW Man2a2 0.232 R8194 G1 225.01 Y 7 80361018 K742E T C missense Het probably benign 0.000 phenotype 07/13/2020
22 635366 UTSW Mapk8 0.766 R8194 G1 225.01 Y 14 33382284 S392T A T missense Het probably benign 0.000 phenotype 07/13/2020
23 635365 UTSW Mark3 0.215 R8194 G1 225.01 Y 12 111592683 I53T T C missense Het probably damaging 0.998 0.524 phenotype 07/13/2020
24 635324 UTSW Mcmdc2 0.096 R8194 G1 225.01 Y 1 9916642 I219V A G missense Het probably benign 0.000 phenotype 07/13/2020
25 635349 UTSW Mlycd 0.092 R8194 G1 219.01 Y 8 119407593 E278V A T missense Het probably benign 0.090 0.361 phenotype 07/13/2020
26 635348 UTSW Muc2 0.102 R8194 G1 225.01 Y 7 141704252 C29F G T missense Het phenotype 07/13/2020
27 635334 UTSW Mup20 0.033 R8194 G1 194.01 N 4 62053484 I77V T C missense Het probably benign 0.007 07/13/2020
28 635359 UTSW Myh3 0.341 R8194 G1 225.01 Y 11 67092002 E849G A G missense Het probably damaging 1.000 phenotype 07/13/2020
29 635352 UTSW Nedd4 1.000 R8194 G1 225.01 Y 9 72686107 N154S A G missense Het probably damaging 0.998 0.112 phenotype 07/13/2020
30 635360 UTSW Olfr397 0.080 R8194 G1 225.01 Y 11 73965414 I269F A T missense Het probably benign 0.001 phenotype 07/13/2020
31 635337 UTSW Pcdh7 0.248 R8194 G1 225.01 Y 5 57720336 N411I A T missense Het probably damaging 1.000 phenotype 07/13/2020
32 635362 UTSW Plekhm1 0.000 R8194 G1 225.01 Y 11 103395060 I183T A G missense Het possibly damaging 0.679 phenotype 07/13/2020
33 635354 UTSW Prkar2a 0.000 R8194 G1 225.01 Y 9 108692511 V19M G A missense Het probably damaging 0.999 phenotype 07/13/2020
34 635353 UTSW Prss35 0.086 R8194 G1 225.01 Y 9 86755613 N145K T G missense Het possibly damaging 0.936 0.171 07/13/2020
35 635356 UTSW Ranbp2 1.000 R8194 G1 225.01 Y 10 58455925 D251E T A missense Het possibly damaging 0.842 phenotype 07/13/2020
36 635344 UTSW Rnf169 0.172 R8194 G1 225.01 Y 7 99926444 V315F C A missense Het probably damaging 1.000 07/13/2020
37 635331 UTSW Slc32a1 1.000 R8194 G1 225.01 Y 2 158613841 Y139H T C missense Het probably damaging 0.997 phenotype 07/13/2020
38 635347 UTSW Slc5a2 0.000 R8194 G1 225.01 Y 7 128271156 V522A T C missense Het probably benign 0.329 phenotype 07/13/2020
39 635339 UTSW Slc6a6 0.000 R8194 G1 225.01 Y 6 91740971 Q297L A T missense Het probably damaging 0.999 0.795 phenotype 07/13/2020
40 635363 UTSW Sos2 0.000 R8194 G1 225.01 Y 12 69598824 Y914D A C missense Het probably damaging 1.000 0.966 phenotype 07/13/2020
41 635333 UTSW Spata1 0.106 R8194 G1 225.01 Y 3 146489859 T32N G T missense Het possibly damaging 0.719 07/13/2020
42 635346 UTSW Srcap 0.958 R8194 G1 225.01 Y 7 127539197 R1180C C T missense Het probably damaging 0.999 phenotype 07/13/2020
43 635351 UTSW St14 1.000 R8194 G1 225.01 Y 9 31131625 M1K A T start codon destroyed Het probably null 0.948 0.862 phenotype 07/13/2020
44 635338 UTSW Tcaf1 0.115 R8194 G1 225.01 Y 6 42675302 T749A T C missense Het probably benign 0.058 07/13/2020
45 635372 UTSW Tcp1 0.942 R8194 G1 225.01 Y 17 12922734 T C critical splice donor site 2 bp Het probably null phenotype 07/13/2020
46 635357 UTSW Tle6 0.194 R8194 G1 225.01 Y 10 81591054 V576A A G missense Het probably damaging 0.983 phenotype 07/13/2020
47 635361 UTSW Ttc25 0.136 R8194 G1 225.01 Y 11 100563676 G429E G A missense Het probably benign 0.057 phenotype 07/13/2020
48 635345 UTSW Usp17lc 1.000 R8194 G1 135.01 N 7 103418200 M234K T A missense Het probably benign 0.003 phenotype 07/13/2020
49 635335 UTSW Zdhhc18 0.155 R8194 G1 225.01 Y 4 133613854 L236P A G missense Het probably damaging 1.000 07/13/2020
50 635350 UTSW Zfp266 0.062 R8194 G1 225.01 Y 9 20500314 D189G T C missense Het probably benign 0.050 phenotype 07/13/2020
51 635375 UTSW Zfp474 0.059 R8194 G1 225.01 Y 18 52639157 D294V A T missense Het probably damaging 0.995 07/13/2020
52 635342 UTSW Zfp568 1.000 R8194 G1 225.01 Y 7 30023333 F568L T C missense Het probably damaging 1.000 phenotype 07/13/2020
53 635340 UTSW Zfp93 0.060 R8194 G1 225.01 Y 7 24276054 K488R A G missense Het probably benign 0.075 07/13/2020
[records 1 to 53 of 53]