Incidental Mutations

51 incidental mutations are currently displayed, and affect 51 genes.
15 are Possibly Damaging.
13 are Probably Damaging.
16 are Probably Benign.
5 are Probably Null.
0 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 51 of 51] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 636416 UTSW Acrbp 0.082 R8217 G1 225.01 Y 6 125060958 L406P T C missense Het probably damaging 0.994 phenotype 07/13/2020
2 636428 UTSW Aph1b 0.000 R8217 G1 225.01 Y 9 66779272 K239E T C missense Het possibly damaging 0.752 phenotype 07/13/2020
3 636439 UTSW Atp13a4 0.000 R8217 G1 225.01 Y 16 29403801 V1102F C A missense Het 07/13/2020
4 636425 UTSW B3gat1 0.118 R8217 G1 225.01 Y 9 26756869 A265T G A missense Het probably damaging 0.998 phenotype 07/13/2020
5 636410 UTSW Bod1l 0.948 R8217 G1 225.01 Y 5 41831507 E419G T C missense Het probably damaging 1.000 0.119 07/13/2020
6 636415 UTSW Ccdc142 0.082 R8217 G1 225.01 Y 6 83103216 L380P T C missense Het probably damaging 1.000 07/13/2020
7 636399 UTSW Cd55b 0.000 R8217 G1 142.47 Y 1 130419600 CTTTT CTTTTT frame shift Het probably null phenotype 07/13/2020
8 636406 UTSW Cfi 0.000 R8217 G1 225.01 Y 3 129855001 N178T A C missense Het possibly damaging 0.605 0.171 phenotype 07/13/2020
9 636401 UTSW Col5a1 1.000 R8217 G1 225.01 Y 2 27922123 D72E T A missense Het unknown phenotype 07/13/2020
10 636426 UTSW Cspg4 0.000 R8217 G1 225.01 Y 9 56890353 V1367D T A missense Het possibly damaging 0.529 phenotype 07/13/2020
11 636409 UTSW D5Ertd579e 0.214 R8217 G1 225.01 Y 5 36614058 S998A A C missense Het probably benign 0.001 0.095 07/13/2020
12 636403 UTSW Ehf 0.749 R8217 G1 225.01 Y 2 103279631 E77G T C missense Het possibly damaging 0.945 0.121 phenotype 07/13/2020
13 636435 UTSW Erap1 0.156 R8217 G1 225.01 Y 13 74672818 I662T T C missense Het probably benign 0.327 phenotype 07/13/2020
14 636400 UTSW F11r 0.115 R8217 G1 217.47 Y 1 171463088 GGTGTG GGTGTGTG makesense Het probably null phenotype 07/13/2020
15 636412 UTSW Klhl8 0.000 R8217 G1 225.01 Y 5 103867600 V486A A G missense Het possibly damaging 0.507 0.635 07/13/2020
16 636431 UTSW Lrrc72 0.093 R8217 G1 225.01 Y 12 36208677 D60E A T missense Het probably damaging 1.000 07/13/2020
17 656451 UTSW March5 0.956 R8217 G1 75.01 Y 19 37207811 C T unclassified Het probably benign phenotype 11/18/2020
18 636432 UTSW Mfsd7c 0.852 R8217 G1 217.47 Y 12 85803148 GTAGTGTATA GTA frame shift Het probably null 07/13/2020
19 636436 UTSW Mtmr12 0.000 R8217 G1 225.01 Y 15 12259640 I365T T C missense Het possibly damaging 0.893 phenotype 07/13/2020
20 636413 UTSW Myl10 0.000 R8217 G1 225.01 Y 5 136697971 V70L G C missense Het probably benign 0.001 0.067 07/13/2020
21 636422 UTSW Nod2 0.184 R8217 G1 225.01 Y 8 88664157 D364A A C missense Het probably benign 0.061 phenotype 07/13/2020
22 636420 UTSW Numa1 1.000 R8217 G1 225.01 Y 7 101992669 M108K T A missense Het possibly damaging 0.663 phenotype 07/13/2020
23 636434 UTSW Nutm2 0.000 R8217 G1 225.01 Y 13 50469723 R152L G T missense Het probably benign 0.155 07/13/2020
24 636402 UTSW Olfr1048 0.108 R8217 G1 225.01 Y 2 86236518 V106M C T missense Het probably benign 0.005 phenotype 07/13/2020
25 636419 UTSW Olfr299 0.088 R8217 G1 225.01 Y 7 86466182 Y257C A G missense Het probably damaging 1.000 phenotype 07/13/2020
26 636430 UTSW Olfr325 0.052 R8217 G1 225.01 Y 11 58580966 M41L A T missense Het probably benign 0.002 phenotype 07/13/2020
27 636433 UTSW Pak1ip1 1.000 R8217 G1 225.01 Y 13 41012650 S350R T A missense Het probably benign 0.342 phenotype 07/13/2020
28 636443 UTSW Pcdha3 0.131 R8217 G1 225.01 Y 18 36946921 F239L T C missense Het probably damaging 0.985 phenotype 07/13/2020
29 636408 UTSW Perm1 0.080 R8217 G1 132.49 N 4 156218068 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT unclassified Het probably benign 07/13/2020
30 636427 UTSW Pkm 1.000 R8217 G1 225.01 N 9 59678809 T524I C T missense Het possibly damaging 0.738 phenotype 07/13/2020
31 636418 UTSW Plekhg2 0.317 R8217 G1 225.01 Y 7 28368292 Q245L T A missense Het probably null 0.998 07/13/2020
32 636445 UTSW Pola2 1.000 R8217 G1 225.01 Y 19 5963827 K26N T A missense Het possibly damaging 0.907 07/13/2020
33 636446 UTSW Prune2 0.000 R8217 G1 225.01 Y 19 17120116 A995S G T missense Het probably benign 0.013 phenotype 07/13/2020
34 636404 UTSW Rap2b R8217 G1 225.01 Y 3 61365130 T25K C A missense Het possibly damaging 0.865 phenotype 07/13/2020
35 636438 UTSW Scrib 1.000 R8217 G1 225.01 Y 15 76067155 S165P A G missense Het probably damaging 0.987 phenotype 07/13/2020
36 636414 UTSW Sdk1 0.071 R8217 G1 225.01 Y 5 142211958 H2122L A T missense Het possibly damaging 0.805 0.304 phenotype 07/13/2020
37 636407 UTSW Sec24b 0.790 R8217 G1 225.01 Y 3 130040950 F200I A T missense Het possibly damaging 0.944 0.069 phenotype 07/13/2020
38 636421 UTSW Sh3rf1 0.230 R8217 G1 225.01 Y 8 61329930 V226A T C missense Het possibly damaging 0.948 phenotype 07/13/2020
39 636442 UTSW Sik1 0.000 R8217 G1 225.01 Y 17 31851312 H141L T A missense Het probably damaging 1.000 0.970 phenotype 07/13/2020
40 636423 UTSW Slc9a5 0.097 R8217 G1 225.01 Y 8 105363324 E638V A T missense Het probably damaging 0.974 07/13/2020
41 636417 UTSW Slco1a5 0.064 R8217 G1 225.01 Y 6 142275476 C15R A G missense Het probably benign 0.134 phenotype 07/13/2020
42 636447 UTSW Slit1 0.000 R8217 G1 222.01 Y 19 41624520 D854N C T missense Het possibly damaging 0.600 phenotype 07/13/2020
43 636444 UTSW Tcof1 1.000 R8217 G1 225.01 Y 18 60829051 A702G G C missense Het possibly damaging 0.837 0.242 phenotype 07/13/2020
44 636411 UTSW Tec 0.067 R8217 G1 225.01 Y 5 72764259 M372K A T missense Het probably benign 0.127 0.190 phenotype 07/13/2020
45 636405 UTSW Tlr2 0.000 R8217 G1 225.01 Y 3 83838066 F237L A G missense Het probably benign 0.167 phenotype 07/13/2020
46 636437 UTSW Trio 1.000 R8217 G1 225.01 Y 15 27818969 L1597Q A T missense Het probably damaging 0.974 phenotype 07/13/2020
47 636398 UTSW Trpa1 0.143 R8217 G1 225.01 Y 1 14887023 M723K A T missense Het probably damaging 0.966 phenotype 07/13/2020
48 636429 UTSW Ttc21a 0.230 R8217 G1 225.01 Y 9 119954628 I592T T C missense Het probably benign 0.002 0.206 07/13/2020
49 636441 UTSW Vmn2r94 0.078 R8217 G1 225.01 N 17 18243724 E768G T C missense Het probably damaging 1.000 07/13/2020
50 636424 UTSW Zfhx3 0.947 R8217 G1 225.01 Y 8 108950717 T2800A A G missense Het probably benign 0.000 phenotype 07/13/2020
51 636440 UTSW Zpld1 0.095 R8217 G1 225.01 Y 16 55226932 A G critical splice donor site 2 bp Het probably null 07/13/2020
[records 1 to 51 of 51]