Incidental Mutations

41 incidental mutations are currently displayed, and affect 41 genes.
5 are Possibly Damaging.
11 are Probably Damaging.
19 are Probably Benign.
2 are Probably Null.
0 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 41 of 41] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 637240 UTSW 4930503L19Rik 0.087 R8233 G1 225.01 N 18 70469616 V42E A T missense Het probably benign 0.022 07/13/2020
2 637200 UTSW Abca12 1.000 R8233 G1 225.01 N 1 71351757 E153G T C missense Het probably benign 0.004 phenotype 07/13/2020
3 637235 UTSW Adamts20 0.128 R8233 G1 225.01 N 15 94291652 I1440S A C missense Het probably benign 0.191 phenotype 07/13/2020
4 637205 UTSW Aspm 0.000 R8233 G1 225.01 N 1 139457304 S229T T A missense Het probably benign 0.279 phenotype 07/13/2020
5 637222 UTSW Atp2b2 0.880 R8233 G1 225.01 N 6 113765719 A T critical splice donor site 2 bp Het probably null phenotype 07/13/2020
6 637213 UTSW Cd101 0.000 R8233 G1 225.01 N 3 100993673 H1032N G T missense Het unknown phenotype 07/13/2020
7 637228 UTSW Col6a2 0.000 R8233 G1 225.01 N 10 76608706 A G critical splice donor site 2 bp Het probably null phenotype 07/13/2020
8 637219 UTSW Crot 0.124 R8233 G1 225.01 N 5 8976027 I320K A T missense Het possibly damaging 0.768 phenotype 07/13/2020
9 637220 UTSW D5Ertd579e 0.335 R8233 G1 225.01 N 5 36615244 D602E A T missense Het probably damaging 0.994 07/13/2020
10 637206 UTSW Degs1 0.245 R8233 G1 225.01 N 1 182279595 V69A A G missense Het probably benign 0.363 phenotype 07/13/2020
11 637209 UTSW Dgkz 0.000 R8233 G1 225.01 N 2 91939649 S557P A G missense Het probably damaging 1.000 phenotype 07/13/2020
12 637226 UTSW Fat1 1.000 R8233 G1 225.01 N 8 44952018 L602Q T A missense Het phenotype 07/13/2020
13 637203 UTSW Gli2 1.000 R8233 G1 225.01 N 1 118844437 Y513N A T missense Het probably damaging 1.000 phenotype 07/13/2020
14 637208 UTSW Gm13762 0.065 R8233 G1 225.01 N 2 88973738 R51H C T missense Het probably benign 0.000 07/13/2020
15 637239 UTSW H2-Q10 0.000 R8233 G1 225.01 N 17 35471086 T202A A G missense Het probably benign 0.278 phenotype 07/13/2020
16 637207 UTSW Hnrnpa3 0.845 R8233 G1 225.01 N 2 75662516 N195D A G missense Het probably benign 0.041 07/13/2020
17 637217 UTSW Ifna1 R8233 G1 225.01 N 4 88850391 T102I C T missense Het possibly damaging 0.613 07/13/2020
18 637230 UTSW Igfbp3 0.000 R8233 G1 225.01 N 11 7210152 H167L T A missense Het probably benign 0.176 phenotype 07/13/2020
19 637204 UTSW Igfn1 0.086 R8233 G1 225.01 N 1 135968044 T1595A T C missense Het probably benign 0.001 07/13/2020
20 637232 UTSW Krt14 1.000 R8233 G1 225.01 N 11 100203352 V472A A G missense Het probably damaging 0.992 phenotype 07/13/2020
21 637236 UTSW Lrrc74b 0.217 R8233 G1 225.01 N 16 17558225 H187L T A missense Het probably benign 0.003 07/13/2020
22 637218 UTSW Magoh 1.000 R8233 G1 225.01 N 4 107880935 V44G T G missense Het possibly damaging 0.923 phenotype 07/13/2020
23 637212 UTSW Mbnl1 0.935 R8233 G1 225.01 N 3 60625130 I274L A T missense Het probably benign 0.007 phenotype 07/13/2020
24 637225 UTSW Olfr60 0.078 R8233 G1 225.01 N 7 140345498 M164L T G missense Het probably benign 0.013 phenotype 07/13/2020
25 637202 UTSW Pdcd1 0.063 R8233 G1 225.01 N 1 94039417 V252A A G missense Het probably damaging 1.000 phenotype 07/13/2020
26 637221 UTSW Peg10 1.000 R8233 G1 166.47 N 6 4756453 C CTCA small insertion Het probably benign phenotype 07/13/2020
27 637234 UTSW Plcxd3 0.099 R8233 G1 225.01 N 15 4516835 D107G A G missense Het possibly damaging 0.773 07/13/2020
28 637227 UTSW Polr2m 0.352 R8233 G1 225.01 N 9 71483584 D112V T A missense Het probably benign 0.000 phenotype 07/13/2020
29 637201 UTSW Ptprn 0.441 R8233 G1 225.01 N 1 75253152 M701K A T missense Het probably damaging 1.000 phenotype 07/13/2020
30 637238 UTSW Rxrb 0.838 R8233 G1 225.01 N 17 34036905 D421G A G missense Het possibly damaging 0.479 phenotype 07/13/2020
31 637231 UTSW Slfn4 0.000 R8233 G1 225.01 N 11 83187529 E381G A G missense Het probably damaging 0.990 phenotype 07/13/2020
32 637237 UTSW Son 0.957 R8233 G1 118.46 N 16 91660334 AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG small deletion Het probably benign phenotype 07/13/2020
33 637229 UTSW Srgap1 0.340 R8233 G1 225.01 N 10 121825436 I530T A G missense Het probably damaging 0.999 phenotype 07/13/2020
34 637233 UTSW Stmn4 0.000 R8233 G1 225.01 N 14 66357892 H122R A G missense Het probably damaging 0.999 07/13/2020
35 637210 UTSW Sycp2 0.000 R8233 G1 225.01 N 2 178356634 E1031G T C missense Het probably damaging 1.000 phenotype 07/13/2020
36 637215 UTSW Tle1 0.635 R8233 G1 225.01 N 4 72124944 T553A T C missense Het probably benign 0.107 07/13/2020
37 637211 UTSW Tnik 0.000 R8233 G1 225.01 N 3 28554937 W217R T A missense Het unknown phenotype 07/13/2020
38 637216 UTSW Tyrp1 0.282 R8233 G1 225.01 N 4 80850953 V161A T C missense Het unknown phenotype 07/13/2020
39 637223 UTSW Usp29 0.000 R8233 G1 225.01 N 7 6962407 F416L T A missense Het probably benign 0.117 07/13/2020
40 637214 UTSW Usp45 0.000 R8233 G1 225.01 N 4 21781736 V34A T C missense Het probably benign 0.329 phenotype 07/13/2020
41 637224 UTSW Vmn1r119 R8233 G1 225.01 N 7 21012007 V150A A G missense Het probably damaging 0.989 07/13/2020
[records 1 to 41 of 41]