Incidental Mutations

48 incidental mutations are currently displayed, and affect 48 genes.
9 are Possibly Damaging.
15 are Probably Damaging.
18 are Probably Benign.
2 are Probably Null.
2 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 48 of 48] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 638190 UTSW 4931409K22Rik 0.148 R8281 G1 225.01 N 5 24549010 H417L T A missense Het probably benign 0.020 07/28/2020
2 638219 UTSW Adam7 0.059 R8281 G1 225.01 N 14 68507885 T630I G A missense Het possibly damaging 0.650 phenotype 07/28/2020
3 638191 UTSW Adgrf3 0.000 R8281 G1 225.01 N 5 30197303 S576G T C missense Het possibly damaging 0.458 07/28/2020
4 638185 UTSW Asxl1 1.000 R8281 G1 225.01 N 2 153399401 R625G A G missense Het probably damaging 1.000 phenotype 07/28/2020
5 638186 UTSW Atp1a1 1.000 R8281 G1 225.01 N 3 101579624 F916L A G missense Het probably benign 0.120 phenotype 07/28/2020
6 638198 UTSW Axl 0.000 R8281 G1 225.01 N 7 25763954 D633N C T missense Het probably benign 0.066 phenotype 07/28/2020
7 638218 UTSW B230359F08Rik 0.069 R8281 G1 225.01 N 14 53795461 R3G A G missense Het possibly damaging 0.482 07/28/2020
8 638202 UTSW Chd9 0.000 R8281 G1 225.01 N 8 91036597 D2350G A G missense Het probably damaging 0.996 07/28/2020
9 638197 UTSW Cic 0.919 R8281 G1 225.01 N 7 25271824 V327I G A missense Het probably benign 0.000 phenotype 07/28/2020
10 638204 UTSW Cmtm1 0.352 R8281 G1 108.46 N 8 104309470 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT small deletion Het probably benign 0.090 07/28/2020
11 638200 UTSW Crym 0.000 R8281 G1 225.01 N 7 120202027 T A unclassified Het probably benign phenotype 07/28/2020
12 638194 UTSW Cyp3a13 0.000 R8281 G1 225.01 N 5 137894297 S495C G C missense Het probably benign 0.010 phenotype 07/28/2020
13 638193 UTSW D5Ertd579e 0.335 R8281 G1 225.01 N 5 36613320 F137I A T missense Het 07/28/2020
14 638208 UTSW Dip2a 0.000 R8281 G1 225.01 N 10 76276604 T1087A T C missense Het probably damaging 0.997 phenotype 07/28/2020
15 638203 UTSW Drc7 0.000 R8281 G1 225.01 N 8 95062177 E288K G A missense Het possibly damaging 0.807 07/28/2020
16 638227 UTSW Epb41l4a 0.000 R8281 G1 225.01 N 18 33878945 E174G T C missense Het probably damaging 1.000 phenotype 07/28/2020
17 638201 UTSW Ern2 0.090 R8281 G1 225.01 N 7 122170260 R848G T C missense Het probably damaging 0.995 phenotype 07/28/2020
18 638183 UTSW F13b 0.000 R8281 G1 225.01 N 1 139510951 R364S G T missense Het probably benign 0.034 phenotype 07/28/2020
19 638214 UTSW F2rl1 0.000 R8281 G1 225.01 N 13 95514077 L99P A G missense Het probably damaging 1.000 phenotype 07/28/2020
20 638192 UTSW Fam193a 0.160 R8281 G1 225.01 N 5 34443436 N171K C A missense Het unknown 07/28/2020
21 638215 UTSW Fst 0.874 R8281 G1 225.01 N 13 114455241 S201P A G missense Het probably benign 0.017 phenotype 07/28/2020
22 638221 UTSW Gm10110 0.175 R8281 G1 225.01 N 14 89898241 V76M C T missense Het noncoding transcript 07/28/2020
23 638181 UTSW Gm597 0.061 R8281 G1 225.01 N 1 28778144 C269Y C T missense Het possibly damaging 0.768 07/28/2020
24 638189 UTSW Gm6460 R8281 G1 225.01 N 5 11597679 M128K T A missense Het probably damaging 0.968 07/28/2020
25 638217 UTSW Gm8232 R8281 G1 147.01 N 14 44437091 I182V A G missense Het 07/28/2020
26 638182 UTSW Gm8251 0.091 R8281 G1 225.01 N 1 44056538 D1800A T G missense Het possibly damaging 0.930 07/28/2020
27 638224 UTSW Kalrn 0.930 R8281 G1 225.01 N 16 34035061 W1956* C T nonsense Het probably null phenotype 07/28/2020
28 638199 UTSW Klk1b16 0.063 R8281 G1 225.01 N 7 44141547 M258V A G missense Het probably benign 0.000 phenotype 07/28/2020
29 638210 UTSW Lta4h 0.000 R8281 G1 225.01 N 10 93453594 D29Y G T missense Het probably damaging 1.000 phenotype 07/28/2020
30 638184 UTSW March7 0.276 R8281 G1 225.01 N 2 60234529 S383L C T missense Het probably benign 0.023 phenotype 07/28/2020
31 638187 UTSW Mob3c 0.184 R8281 G1 225.01 N 4 115831438 I56T T C missense Het probably benign 0.191 phenotype 07/28/2020
32 638205 UTSW Msl2 0.948 R8281 G1 225.01 N 9 101101695 S423P T C missense Het probably benign 0.103 07/28/2020
33 638211 UTSW Otop3 0.074 R8281 G1 225.01 N 11 115345075 I511T T C missense Het possibly damaging 0.881 07/28/2020
34 638207 UTSW Pbld2 0.000 R8281 G1 225.01 N 10 63048026 L90R T G missense Het probably damaging 1.000 07/28/2020
35 638220 UTSW Pcdh8 0.000 R8281 G1 225.01 N 14 79769479 V548A A G missense Het probably damaging 0.981 phenotype 07/28/2020
36 638195 UTSW Peg10 1.000 R8281 G1 149.47 N 6 4756431 CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC CATC small deletion Het probably benign phenotype 07/28/2020
37 638188 UTSW Plch2 0.000 R8281 G1 225.01 N 4 155006973 M228L T A missense Het probably benign 0.069 phenotype 07/28/2020
38 638222 UTSW Prkdc 0.946 R8281 G1 225.01 N 16 15705253 C1180R T C missense Het probably damaging 1.000 phenotype 07/28/2020
39 638196 UTSW Rasl2-9 0.907 R8281 G1 225.01 N 7 5125352 L193* A T nonsense Het probably null 07/28/2020
40 638216 UTSW Rbp3 0.756 R8281 G1 225.01 N 14 33956363 K756R A G missense Het probably benign 0.005 phenotype 07/28/2020
41 638180 UTSW Rp1 0.108 R8281 G1 225.01 N 1 4347916 E991G T C missense Het probably damaging 0.996 phenotype 07/28/2020
42 638213 UTSW Slc12a7 0.000 R8281 G1 225.01 N 13 73790677 R191H G A missense Het probably damaging 1.000 phenotype 07/28/2020
43 638225 UTSW Spaca6 0.070 R8281 G1 225.01 N 17 17832059 N87S A G missense Het possibly damaging 0.781 phenotype 07/28/2020
44 638209 UTSW Stab2 0.000 R8281 G1 225.01 N 10 86873864 V1639E A T missense Het probably damaging 0.978 phenotype 07/28/2020
45 638223 UTSW Thpo 0.000 R8281 G1 225.01 N 16 20725775 N235S T C missense Het possibly damaging 0.907 phenotype 07/28/2020
46 638226 UTSW Tmem63b 1.000 R8281 G1 207.01 N 17 45660796 H831L T A missense Het probably benign 0.227 07/28/2020
47 638212 UTSW Tomm20l 0.000 R8281 G1 225.01 N 12 71111467 V8A T C missense Het probably benign 0.181 07/28/2020
48 638206 UTSW Vill 0.092 R8281 G1 225.01 N 9 119058479 S104P T C missense Het probably damaging 1.000 phenotype 07/28/2020
[records 1 to 48 of 48]