Incidental Mutations

63 incidental mutations are currently displayed, and affect 63 genes.
13 are Possibly Damaging.
28 are Probably Damaging.
15 are Probably Benign.
4 are Probably Null.
1 create premature stop codons.
3 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 63 of 63] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 639025 UTSW 1700020N01Rik 0.062 R8297 G1 225.01 N 10 21621679 L73P T C missense Het probably damaging 0.980 07/28/2020
2 639037 UTSW 4933412E24Rik 0.058 R8297 G1 225.01 N 15 60015675 R305S T G missense Het probably damaging 0.999 07/28/2020
3 639049 UTSW Adamts19 0.000 R8297 G1 225.01 N 18 58837848 V168E T A missense Het probably damaging 0.997 phenotype 07/28/2020
4 639033 UTSW Ankrd34b 0.057 R8297 G1 225.01 N 13 92439589 L443Q T A missense Het probably damaging 1.000 07/28/2020
5 638998 UTSW Ano3 0.074 R8297 G1 225.01 N 2 110661271 Y887H A G missense Het probably damaging 1.000 phenotype 07/28/2020
6 639002 UTSW Arhgef2 0.607 R8297 G1 225.01 N 3 88639432 H553L A T missense Het probably benign 0.001 phenotype 07/28/2020
7 639031 UTSW Atxn1 0.000 R8297 G1 225.01 N 13 45567029 N463K G T missense Het probably benign 0.000 phenotype 07/28/2020
8 639046 UTSW Birc6 1.000 R8297 G1 225.01 N 17 74625104 A G critical splice acceptor site Het probably null phenotype 07/28/2020
9 638991 UTSW C4bp 0.000 R8297 G1 225.01 N 1 130636745 S401P A G missense Het probably damaging 0.999 07/28/2020
10 639050 UTSW Cd5 0.000 R8297 G1 225.01 N 19 10720245 R457W T A missense Het probably damaging 1.000 phenotype 07/28/2020
11 639008 UTSW Chek2 0.000 R8297 G1 225.01 N 5 110848436 Y127D T G missense Het probably damaging 1.000 phenotype 07/28/2020
12 639012 UTSW Clec4a1 0.060 R8297 G1 225.01 N 6 122922001 V10M G A missense Het probably damaging 0.999 07/28/2020
13 639029 UTSW Cltc 0.953 R8297 G1 225.01 N 11 86712631 Y790H A G missense Het probably damaging 0.999 phenotype 07/28/2020
14 638999 UTSW Cops2 1.000 R8297 G1 225.01 N 2 125859108 T C unclassified Het probably benign phenotype 07/28/2020
15 639028 UTSW Cyb5d2 0.000 R8297 G1 225.01 N 11 72789103 F122S A G missense Het probably damaging 1.000 07/28/2020
16 639030 UTSW Daam1 1.000 R8297 G1 225.01 N 12 71951915 L548H T A missense Het unknown phenotype 07/28/2020
17 639034 UTSW Dcp1a 0.270 R8297 G1 225.01 N 14 30522926 T570A A G missense Het possibly damaging 0.872 phenotype 07/28/2020
18 639047 UTSW Dsg1a 0.107 R8297 G1 225.01 N 18 20332033 N427T A C missense Het probably benign 0.017 phenotype 07/28/2020
19 639035 UTSW Ear14 R8297 G1 225.01 N 14 51204107 D140V A T missense Het probably damaging 1.000 07/28/2020
20 638989 UTSW Epha4 0.941 R8297 G1 225.01 N 1 77506910 F154C A C missense Het probably damaging 1.000 phenotype 07/28/2020
21 639042 UTSW Ets2 1.000 R8297 G1 225.01 N 16 95706454 V12M G A missense Het probably damaging 1.000 phenotype 07/28/2020
22 639040 UTSW Fbxo40 0.108 R8297 G1 225.01 N 16 36969308 T480I G A missense Het probably damaging 0.976 phenotype 07/28/2020
23 639003 UTSW Fdps 0.963 R8297 G1 217.01 N 3 89093741 Y322N A T missense Het probably damaging 0.992 phenotype 07/28/2020
24 638995 UTSW Gca 0.085 R8297 G1 225.01 N 2 62686356 M132T T C missense Het probably benign 0.004 phenotype 07/28/2020
25 638993 UTSW Ifi203 0.087 R8297 G1 225.01 N 1 173937930 K26T T G missense Het probably damaging 0.999 07/28/2020
26 639004 UTSW Itga10 0.126 R8297 G1 225.01 N 3 96654800 R668G A G missense Het probably damaging 1.000 phenotype 07/28/2020
27 639021 UTSW Itgal 0.147 R8297 G1 225.01 N 7 127330466 I1185T T C missense Het unknown phenotype 07/28/2020
28 638990 UTSW Kcnj13 1.000 R8297 G1 225.01 N 1 87386467 N344K A T missense Het probably damaging 1.000 phenotype 07/28/2020
29 639011 UTSW Kdm5a 1.000 R8297 G1 225.01 N 6 120381555 L186F A T missense Het probably benign 0.001 phenotype 07/28/2020
30 639007 UTSW Klhl8 0.000 R8297 G1 225.01 N 5 103863088 N624D T C missense Het probably benign 0.227 07/28/2020
31 639014 UTSW Klrb1 0.000 R8297 G1 225.01 N 6 128712259 T83K G T missense Het possibly damaging 0.566 phenotype 07/28/2020
32 639039 UTSW Krt77 0.000 R8297 G1 111.47 N 15 101859972 TGCCGCCGCCGCCGCCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCGCCGC small deletion Het probably benign phenotype 07/28/2020
33 639043 UTSW Ltb 0.142 R8297 G1 225.01 N 17 35194679 R53L G T missense Het probably benign 0.002 phenotype 07/28/2020
34 639032 UTSW Mterf3 1.000 R8297 G1 225.01 N 13 66907158 V69A A G missense Het phenotype 07/28/2020
35 639022 UTSW Mvb12a 0.113 R8297 G1 225.01 N 8 71545244 K101E A G missense Het probably damaging 1.000 07/28/2020
36 639024 UTSW Nbeal2 0.263 R8297 G1 225.01 N 9 110635341 Q1110L T A missense Het possibly damaging 0.889 phenotype 07/28/2020
37 638994 UTSW Neb 0.881 R8297 G1 225.01 N 2 52308763 T389S T A missense Het possibly damaging 0.779 phenotype 07/28/2020
38 639048 UTSW Nol4 0.432 R8297 G1 225.01 N 18 23040012 F11L A G missense Het probably damaging 0.992 07/28/2020
39 639044 UTSW Olfr132 0.075 R8297 G1 225.01 N 17 38130593 S200P A G missense Het probably damaging 0.970 phenotype 07/28/2020
40 639010 UTSW Olfr441 0.066 R8297 G1 225.01 N 6 43116506 I255V A G missense Het probably benign 0.391 phenotype 07/28/2020
41 639020 UTSW Olfr675 0.368 R8297 G1 225.01 N 7 105024678 G97R C T missense Het probably benign 0.140 phenotype 07/28/2020
42 639026 UTSW Olfr9 0.061 R8297 G1 225.01 N 10 128990839 L309P T C missense Het possibly damaging 0.873 phenotype 07/28/2020
43 639019 UTSW Pde2a 0.786 R8297 G1 225.01 N 7 101504673 Y487N T A missense Het possibly damaging 0.858 phenotype 07/28/2020
44 639023 UTSW Pde4a 0.215 R8297 G1 211.01 N 9 21166108 P61S C T missense Het possibly damaging 0.938 phenotype 07/28/2020
45 639006 UTSW Pramef25 0.063 R8297 G1 225.01 N 4 143949120 T379S T A missense Het probably benign 0.077 07/28/2020
46 638997 UTSW Prr5l 0.217 R8297 G1 225.01 N 2 101741285 A G critical splice donor site 2 bp Het probably null 07/28/2020
47 639013 UTSW Ptpn6 0.475 R8297 G1 225.01 N 6 124728651 T179I G A missense Het possibly damaging 0.838 phenotype 07/28/2020
48 639001 UTSW Ralyl 0.197 R8297 G1 225.01 N 3 14039776 S34P T C missense Het probably benign 0.327 07/28/2020
49 639045 UTSW Rftn1 0.075 R8297 G1 225.01 N 17 50047380 A318D G T missense Het probably damaging 0.999 0.390 phenotype 07/28/2020
50 639041 UTSW Robo2 0.937 R8297 G1 225.01 N 16 74015926 C293* A T nonsense Het probably null phenotype 07/28/2020
51 639027 UTSW Rtn4 0.724 R8297 G1 225.01 N 11 29705536 D169E T G missense Het probably damaging 0.997 phenotype 07/28/2020
52 639036 UTSW Slc22a22 0.080 R8297 G1 225.01 N 15 57259110 V157E A T missense Het probably damaging 1.000 07/28/2020
53 639018 UTSW Sytl2 0.323 R8297 G1 225.01 N 7 90385075 T498A A G missense Het probably benign 0.000 phenotype 07/28/2020
54 639000 UTSW Tgm6 0.000 R8297 G1 225.01 N 2 130137438 V163I G A missense Het probably benign 0.000 phenotype 07/28/2020
55 639009 UTSW Tnpo3 1.000 R8297 G1 225.01 N 6 29582303 C187S A T missense Het possibly damaging 0.911 phenotype 07/28/2020
56 638996 UTSW Ttn 1.000 R8297 G1 225.01 N 2 76786141 A G critical splice donor site 2 bp Het probably null phenotype 07/28/2020
57 638992 UTSW Vangl2 1.000 R8297 G1 225.01 N 1 172009946 V99F C A missense Het possibly damaging 0.929 phenotype 07/28/2020
58 639015 UTSW Vmn1r167 0.066 R8297 G1 225.01 N 7 23504790 C267Y C T missense Het probably damaging 0.999 07/28/2020
59 639016 UTSW Vsig10l 0.171 R8297 G1 225.01 N 7 43464107 V161A T C missense Het possibly damaging 0.505 07/28/2020
60 638988 UTSW Xrcc5 1.000 R8297 G1 225.01 N 1 72325085 R232Q G A missense Het possibly damaging 0.469 phenotype 07/28/2020
61 639038 UTSW Xrcc6 0.000 R8297 G1 225.01 N 15 82029262 F365L C G missense Het probably damaging 1.000 phenotype 07/28/2020
62 639005 UTSW Zcchc11 0.000 R8297 G1 225.01 N 4 108479708 A210T G A missense Het possibly damaging 0.858 phenotype 07/28/2020
63 639017 UTSW Zdhhc13 1.000 R8297 G1 225.01 N 7 48815509 Y389C A G missense Het probably damaging 0.960 phenotype 07/28/2020
[records 1 to 63 of 63]