Incidental Mutations

60 incidental mutations are currently displayed, and affect 60 genes.
7 are Possibly Damaging.
21 are Probably Damaging.
26 are Probably Benign.
3 are Probably Null.
1 create premature stop codons.
4 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 60 of 60] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 661371 UTSW 0610037L13Rik 0.151 R8676 G1 225.01 Y 4 107895599 (GRCm38) N152D A G missense Het unknown 2021-03-08
2 661397 UTSW 1700021F05Rik 0.155 R8676 G1 225.01 Y 10 43532937 (GRCm38) L70S A G missense Het probably benign 0.137 2021-03-08
3 661387 UTSW Acsm3 0.000 R8676 G1 225.01 Y 7 119775169 (GRCm38) S281R T A missense Het probably damaging 1.000 0.324 phenotype 2021-03-08
4 673239 UTSW Adipor2 0.278 R8676 G1 225.01 Y 6 119363486 (GRCm38) G T critical splice donor site Het probably benign phenotype 2021-06-16
5 661413 UTSW Alk 0.182 R8676 G1 225.01 Y 17 71897941 (GRCm38) S1079G T C missense Het probably damaging 0.977 phenotype 2021-03-08
6 661383 UTSW Ankrd27 0.000 R8676 G1 225.01 Y 7 35602584 (GRCm38) T C critical splice donor site 2 bp Het probably null 0.950 2021-03-08
7 661401 UTSW Anxa6 0.151 R8676 G1 225.01 Y 11 55001282 (GRCm38) E283* C A nonsense Het probably null 0.976 phenotype 2021-03-08
8 661369 UTSW Bnc2 1.000 R8676 G1 225.01 Y 4 84276313 (GRCm38) H858R T C missense Het possibly damaging 0.655 phenotype 2021-03-08
9 661412 UTSW Btnl6 0.077 R8676 G1 225.01 Y 17 34508069 (GRCm38) S496G T C missense Het probably benign 0.001 0.085 2021-03-08
10 661400 UTSW Ccdc88a 1.000 R8676 G1 225.01 Y 11 29460860 (GRCm38) S449P T C missense Het probably benign 0.051 phenotype 2021-03-08
11 661398 UTSW Cdh23 0.677 R8676 G1 225.01 Y 10 60410910 (GRCm38) D916E A T missense Het probably damaging 1.000 phenotype 2021-03-08
12 661420 UTSW Cfap43 0.141 R8676 G1 225.01 Y 19 47748017 (GRCm38) L1345H A T missense Het possibly damaging 0.954 0.171 phenotype 2021-03-08
13 661390 UTSW Cyld 0.000 R8676 G1 225.01 Y 8 88729510 (GRCm38) H396L A T missense Het probably benign 0.016 phenotype 2021-03-08
14 661365 UTSW Cyp20a1 0.000 R8676 G1 225.01 Y 1 60379420 (GRCm38) T340A A G missense Het possibly damaging 0.946 phenotype 2021-03-08
15 661380 UTSW Dera 0.000 R8676 G1 225.01 Y 6 137830204 (GRCm38) I217F A T missense Het probably damaging 0.999 2021-03-08
16 661406 UTSW Dnah11 0.671 R8676 G1 225.01 Y 12 118190804 (GRCm38) L247P A G missense Het probably damaging 1.000 phenotype 2021-03-08
17 661404 UTSW Eftud2 1.000 R8676 G1 225.01 Y 11 102868621 (GRCm38) T152M G A missense Het probably damaging 1.000 phenotype 2021-03-08
18 661396 UTSW Epb41l2 0.268 R8676 G1 225.01 N 10 25443776 (GRCm38) T169M C T missense Het probably benign 0.026 phenotype 2021-03-08
19 661411 UTSW Fam186a 0.059 R8676 G1 225.01 Y 15 99947142 (GRCm38) D407G T C missense Het unknown 0.084 2021-03-08
20 661418 UTSW Fam189a2 0.089 R8676 G1 225.01 Y 19 23988494 (GRCm38) K214E T C missense Het probably damaging 0.998 2021-03-08
21 661407 UTSW Gli3 1.000 R8676 G1 225.01 Y 13 15715034 (GRCm38) C578S T A missense Het probably damaging 1.000 0.975 phenotype 2021-03-08
22 661373 UTSW Gm436 0.055 R8676 G1 225.01 N 4 144670113 (GRCm38) R350C G A missense Het possibly damaging 0.945 2021-03-08
23 661377 UTSW Gm6408 0.071 R8676 G1 225.01 N 5 146482427 (GRCm38) N84S A G missense Het probably benign 0.019 2021-03-08
24 661405 UTSW Heatr5a 0.193 R8676 G1 214.49 N 12 51887919 (GRCm38) AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGTGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA critical splice donor site Het probably benign 2021-03-08
25 661386 UTSW Herc2 0.932 R8676 G1 225.01 Y 7 56188613 (GRCm38) T3296K C A missense Het probably damaging 1.000 0.562 phenotype 2021-03-08
26 673238 UTSW Hnf4g 0.212 R8676 G1 225.01 Y 3 3643073 (GRCm38) A T splice site Het probably benign phenotype 2021-06-16
27 661378 UTSW Hyal4 0.000 R8676 G1 225.01 Y 6 24755827 (GRCm38) Q15K C A missense Het probably damaging 0.994 phenotype 2021-03-08
28 673241 UTSW Itpr3 0.000 R8676 G1 225.01 Y 17 27118677 (GRCm38) G A unclassified Het probably benign 0.085 phenotype 2021-06-16
29 661368 UTSW Kcna3 0.451 R8676 G1 188.01 Y 3 107036592 (GRCm38) E57G A G missense Het probably damaging 0.972 phenotype 2021-03-08
30 661385 UTSW Kcnc3 0.000 R8676 G1 225.01 Y 7 44591596 (GRCm38) D237E C A missense Het probably benign 0.058 0.076 phenotype 2021-03-08
31 661414 UTSW Map3k8 0.000 R8676 G1 225.01 Y 18 4343137 (GRCm38) V130A A G missense Het probably benign 0.010 0.085 phenotype 2021-03-08
32 661415 UTSW Mpp7 0.128 R8676 G1 225.01 Y 18 7440430 (GRCm38) A G critical splice donor site 2 bp Het probably null phenotype 2021-03-08
33 661402 UTSW Myh13 0.110 R8676 G1 225.01 Y 11 67342485 (GRCm38) L610Q T A missense Het probably damaging 1.000 0.355 2021-03-08
34 661366 UTSW Olfr1020 0.215 R8676 G1 225.01 Y 2 85849902 (GRCm38) M150K T A missense Het probably benign 0.028 phenotype 2021-03-08
35 661372 UTSW Olfr1339 0.080 R8676 G1 225.01 Y 4 118735038 (GRCm38) P170T C A missense Het probably damaging 0.995 phenotype 2021-03-08
36 661392 UTSW Olfr917 0.053 R8676 G1 225.01 Y 9 38665768 (GRCm38) I25M T C missense Het probably benign 0.017 phenotype 2021-03-08
37 661417 UTSW Pcdhb5 0.122 R8676 G1 225.01 Y 18 37321076 (GRCm38) T170S A T missense Het probably benign 0.014 phenotype 2021-03-08
38 661399 UTSW Polr3b 1.000 R8676 G1 225.01 Y 10 84680387 (GRCm38) H626Q T A missense Het probably benign 0.003 phenotype 2021-03-08
39 661419 UTSW Prkg1 0.544 R8676 G1 225.01 Y 19 31764746 (GRCm38) L26Q A T missense Het probably damaging 0.979 phenotype 2021-03-08
40 661416 UTSW Prob1 0.159 R8676 G1 225.01 Y 18 35653986 (GRCm38) N405S T C missense Het possibly damaging 0.528 2021-03-08
41 661388 UTSW Proz 0.060 R8676 G1 225.01 Y 8 13073630 (GRCm38) S300R T G missense Het probably damaging 1.000 phenotype 2021-03-08
42 661381 UTSW Psg19 0.053 R8676 G1 225.01 Y 7 18794065 (GRCm38) I251T A G missense Het probably benign 0.000 2021-03-08
43 661410 UTSW Rcbtb1 0.271 R8676 G1 225.01 Y 14 59229952 (GRCm38) I413T T C missense Het possibly damaging 0.503 phenotype 2021-03-08
44 661409 UTSW Rnf144b 0.000 R8676 G1 225.01 Y 13 47228976 (GRCm38) Y103N T A missense Het probably damaging 0.999 0.867 2021-03-08
45 661391 UTSW Rspry1 0.363 R8676 G1 225.01 Y 8 94632119 (GRCm38) G194R G C missense Het probably benign 0.009 phenotype 2021-03-08
46 661393 UTSW Scn2b 0.000 R8676 G1 225.01 Y 9 45125619 (GRCm38) I142V A G missense Het probably damaging 0.999 phenotype 2021-03-08
47 661403 UTSW Spata20 0.256 R8676 G1 225.01 Y 11 94481781 (GRCm38) L588H A T missense Het probably damaging 1.000 2021-03-08
48 661374 UTSW Stk32b 0.088 R8676 G1 225.01 Y 5 37457159 (GRCm38) H335L T A missense Het probably benign 0.002 phenotype 2021-03-08
49 661395 UTSW Taar4 0.126 R8676 G1 225.01 Y 10 23960903 (GRCm38) D137A A C missense Het possibly damaging 0.564 phenotype 2021-03-08
50 661367 UTSW Tchh 0.078 R8676 G1 170.46 N 3 93446708 (GRCm38) CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC small deletion Het probably benign 2021-03-08
51 661370 UTSW Tek 1.000 R8676 G1 225.01 Y 4 94849837 (GRCm38) H708L A T missense Het probably benign 0.000 phenotype 2021-03-08
52 661394 UTSW Tmem89 0.097 R8676 G1 225.01 Y 9 108915027 (GRCm38) L132F C T missense Het unknown 2021-03-08
53 661375 UTSW Ugt2b38 0.112 R8676 G1 225.01 Y 5 87411822 (GRCm38) I404V T C missense Het probably benign 0.115 2021-03-08
54 661379 UTSW Vmn1r16 0.170 R8676 G1 225.01 Y 6 57322829 (GRCm38) M269I C T missense Het probably benign 0.012 0.085 2021-03-08
55 661408 UTSW Vmn1r201 0.114 R8676 G1 225.01 Y 13 22475252 (GRCm38) K212R A G missense Het probably damaging 0.998 0.633 2021-03-08
56 661376 UTSW Vmn2r11 0.077 R8676 G1 225.01 Y 5 109053760 (GRCm38) F293V A C missense Het probably damaging 1.000 2021-03-08
57 673240 UTSW Zdhhc17 0.000 R8676 G1 225.01 Y 10 110962379 (GRCm38) A T intron Het probably benign phenotype 2021-06-16
58 661389 UTSW Zfp423 0.805 R8676 G1 225.01 Y 8 87782710 (GRCm38) M335I C A missense Het probably benign 0.041 phenotype 2021-03-08
59 661382 UTSW Zfp74 0.088 R8676 G1 225.01 N 7 29934654 (GRCm38) Y543C T C missense Het probably damaging 1.000 2021-03-08
60 661384 UTSW Zfp975 0.066 R8676 G1 225.01 Y 7 42662840 (GRCm38) S116R A T missense Het probably benign 0.441 0.085 2021-03-08
[records 1 to 60 of 60]