Incidental Mutations

75 incidental mutations are currently displayed, and affect 75 genes.
17 are Possibly Damaging.
25 are Probably Damaging.
23 are Probably Benign.
7 are Probably Null.
5 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 75 of 75] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 662441 UTSW 2810408A11Rik 0.061 R8726 G1 225.01 N 11 69898381 S331P A G missense Het possibly damaging 0.939 03/08/2021
2 662425 UTSW 4930433I11Rik 0.074 R8726 G1 225.01 N 7 40994802 M632V A G missense Het probably benign 0.038 03/08/2021
3 662440 UTSW 9930111J21Rik2 0.303 R8726 G1 225.01 N 11 49019680 V642G A C missense Het probably damaging 1.000 03/08/2021
4 662436 UTSW Acsbg1 0.159 R8726 G1 225.01 N 9 54618178 E363G T C missense Het probably damaging 1.000 phenotype 03/08/2021
5 662439 UTSW Ank3 0.853 R8726 G1 225.01 N 10 69987254 H584Q T A missense Het phenotype 03/08/2021
6 662434 UTSW Ankrd11 1.000 R8726 G1 225.01 N 8 122894026 L1029Q A T missense Het possibly damaging 0.905 phenotype 03/08/2021
7 662426 UTSW Anpep 0.000 R8726 G1 225.01 N 7 79840893 V292I C T missense Het probably benign 0.003 phenotype 03/08/2021
8 662432 UTSW Atmin 1.000 R8726 G1 225.01 N 8 116954786 D175N G A missense Het possibly damaging 0.634 phenotype 03/08/2021
9 662465 UTSW B4galt6 0.200 R8726 G1 225.01 N 18 20688393 I359M T C missense Het possibly damaging 0.857 phenotype 03/08/2021
10 662449 UTSW Bicd2 0.542 R8726 G1 225.01 N 13 49379429 D497G A G missense Het probably damaging 0.993 phenotype 03/08/2021
11 662417 UTSW Camkk2 0.175 R8726 G1 225.01 N 5 122743939 D418E G T missense Het probably benign 0.189 phenotype 03/08/2021
12 662422 UTSW Cntn3 0.000 R8726 G1 225.01 N 6 102169053 Y942* A T nonsense Het probably null 03/08/2021
13 662458 UTSW Col8a1 0.000 R8726 G1 225.01 N 16 57628775 R124H C T missense Het probably damaging 0.998 phenotype 03/08/2021
14 662455 UTSW Coro7 0.101 R8726 G1 225.01 N 16 4668755 T185A T C missense Het possibly damaging 0.954 phenotype 03/08/2021
15 662412 UTSW Creb3 0.801 R8726 G1 225.01 N 4 43566747 P364S C T missense Het probably benign 0.308 phenotype 03/08/2021
16 662466 UTSW Csf1r 0.898 R8726 G1 225.01 N 18 61117656 T480S A T missense Het probably benign 0.165 phenotype 03/08/2021
17 662437 UTSW Csnk1g1 0.199 R8726 G1 225.01 N 9 66002271 H223Q T A missense Het probably damaging 1.000 phenotype 03/08/2021
18 662442 UTSW Ctns 0.187 R8726 G1 225.01 N 11 73187787 V171M C T missense Het probably benign 0.184 phenotype 03/08/2021
19 662416 UTSW Dhx15 0.955 R8726 G1 225.01 N 5 52154226 N637K A T missense Het probably benign 0.011 phenotype 03/08/2021
20 662456 UTSW Eif4g1 0.968 R8726 G1 225.01 N 16 20675482 Y103H T C missense Het probably damaging 0.998 phenotype 03/08/2021
21 662427 UTSW Eif4g2 1.000 R8726 G1 225.01 N 7 111077422 R295H C T missense Het probably damaging 1.000 phenotype 03/08/2021
22 662399 UTSW Fam126b 0.867 R8726 G1 225.01 N 1 58546126 T171A T C missense Het possibly damaging 0.821 03/08/2021
23 662430 UTSW Fat1 1.000 R8726 G1 225.01 N 8 45024169 P2084L C T missense Het probably benign 0.232 phenotype 03/08/2021
24 662409 UTSW Fat4 1.000 R8726 G1 225.01 N 3 39010498 R4868G A G missense Het probably damaging 0.997 phenotype 03/08/2021
25 662433 UTSW Fbxo31 0.000 R8726 G1 199.01 N 8 121555275 Y295* A T nonsense Het probably null phenotype 03/08/2021
26 662401 UTSW Fmn2 0.810 R8726 G1 225.01 N 1 174609838 T1125N C A missense Het possibly damaging 0.863 phenotype 03/08/2021
27 662428 UTSW Foxi2 0.000 R8726 G1 115.01 N 7 135410404 P7Q C A missense Het probably damaging 0.979 phenotype 03/08/2021
28 662415 UTSW Hmx1 R8726 G1 225.01 N 5 35391756 P131L C T missense Het probably damaging 0.999 phenotype 03/08/2021
29 662450 UTSW Hrh2 0.000 R8726 G1 225.01 N 13 54214152 L49P T C missense Het probably damaging 0.996 phenotype 03/08/2021
30 662420 UTSW Igkv6-14 0.314 R8726 G1 225.01 N 6 70435141 V53A A G missense Het possibly damaging 0.628 03/08/2021
31 662396 UTSW Kcnb2 0.000 R8726 G1 225.01 N 1 15710652 Q583K C A missense Het probably benign 0.001 phenotype 03/08/2021
32 662445 UTSW Kcns3 0.109 R8726 G1 225.01 N 12 11091691 S336P A G missense Het probably damaging 1.000 phenotype 03/08/2021
33 662460 UTSW Kremen2 0.060 R8726 G1 225.01 N 17 23742746 F262L G T missense Het probably damaging 0.997 phenotype 03/08/2021
34 662444 UTSW Krtap9-1 R8726 G1 225.01 N 11 99873751 C104* T A nonsense Het probably null 03/08/2021
35 662438 UTSW Ky 0.291 R8726 G1 225.01 N 9 102527903 Y199C A G missense Het probably damaging 1.000 phenotype 03/08/2021
36 662413 UTSW L1td1 0.092 R8726 G1 225.01 N 4 98733978 L259R T G missense Het probably damaging 0.979 phenotype 03/08/2021
37 662410 UTSW Lrba 0.000 R8726 G1 225.01 N 3 86353755 T1473A A G missense Het probably benign 0.000 phenotype 03/08/2021
38 662424 UTSW Lrp6 0.964 R8726 G1 225.01 N 6 134507661 L333* A T nonsense Het probably null phenotype 03/08/2021
39 662423 UTSW Lrrc23 0.000 R8726 G1 225.01 N 6 124776080 N201S T C missense Het probably benign 0.027 03/08/2021
40 662398 UTSW Map4k4 1.000 R8726 G1 225.01 N 1 40003982 P666T C A missense Het possibly damaging 0.948 phenotype 03/08/2021
41 662414 UTSW Matn1 0.000 R8726 G1 225.01 N 4 130952203 D389E T A missense Het probably damaging 1.000 phenotype 03/08/2021
42 662463 UTSW Mdc1 0.941 R8726 G1 225.01 N 17 35847583 G285V G T missense Het probably benign 0.044 phenotype 03/08/2021
43 662453 UTSW Mettl17 0.953 R8726 G1 225.01 N 14 51890730 T C critical splice donor site 2 bp Het probably null 03/08/2021
44 662404 UTSW Neurod1 0.913 R8726 G1 225.01 N 2 79454086 F318I A T missense Het possibly damaging 0.491 phenotype 03/08/2021
45 662464 UTSW Nfya 1.000 R8726 G1 225.01 N 17 48392417 T213A T C missense Het probably damaging 0.987 0.128 phenotype 03/08/2021
46 662469 UTSW Nmrk1 0.000 R8726 G1 225.01 N 19 18639538 T17M C T missense Het probably damaging 1.000 phenotype 03/08/2021
47 662411 UTSW Ntrk1 1.000 R8726 G1 225.01 N 3 87786089 D245E A C missense Het probably benign 0.105 phenotype 03/08/2021
48 662406 UTSW Nup160 0.969 R8726 G1 225.01 N 2 90733201 H1370Q C A missense Het possibly damaging 0.861 phenotype 03/08/2021
49 662405 UTSW Olfr1151 0.129 R8726 G1 225.01 N 2 87857817 V214A T C missense Het probably benign 0.138 phenotype 03/08/2021
50 662451 UTSW Olfr745 0.104 R8726 G1 225.01 N 14 50643246 K316Q A C missense Het probably benign 0.002 phenotype 03/08/2021
51 662435 UTSW Olfr986 0.097 R8726 G1 225.01 N 9 40187367 V84E T A missense Het probably damaging 0.957 phenotype 03/08/2021
52 662454 UTSW Parp4 0.143 R8726 G1 225.01 N 14 56629099 R1040H G A missense Het probably benign 0.036 phenotype 03/08/2021
53 662419 UTSW Pdia4 0.000 R8726 G1 225.01 N 6 47808266 E56* C A nonsense Het probably null phenotype 03/08/2021
54 662457 UTSW Pdia5 0.134 R8726 G1 225.01 N 16 35449414 F175S A G missense Het probably damaging 1.000 phenotype 03/08/2021
55 662467 UTSW Piezo2 1.000 R8726 G1 225.01 N 18 63109885 S621N C T missense Het probably benign 0.000 phenotype 03/08/2021
56 662443 UTSW Pigw 0.153 R8726 G1 225.01 N 11 84877817 T229A T C missense Het possibly damaging 0.844 phenotype 03/08/2021
57 662429 UTSW Rasa3 1.000 R8726 G1 225.01 N 8 13576381 Y734C T C missense Het probably benign 0.003 phenotype 03/08/2021
58 662397 UTSW Rims1 0.634 R8726 G1 225.01 N 1 22594100 D178G T C missense Het possibly damaging 0.878 phenotype 03/08/2021
59 662446 UTSW Rps7 0.965 R8726 G1 225.01 N 12 28631715 I139T A G missense Het probably benign 0.260 phenotype 03/08/2021
60 662468 UTSW Sall3 1.000 R8726 G1 192.01 N 18 80986493 D15G T C missense Het possibly damaging 0.893 phenotype 03/08/2021
61 662402 UTSW Scn1a 1.000 R8726 G1 225.01 N 2 66303639 V137D A T missense Het probably benign 0.000 phenotype 03/08/2021
62 662400 UTSW Slc23a3 0.000 R8726 G1 225.01 N 1 75129529 P349S G A missense Het probably benign 0.021 03/08/2021
63 662459 UTSW Son 0.956 R8726 G1 115.46 N 16 91656691 CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC unclassified Het probably benign phenotype 03/08/2021
64 662418 UTSW Stard13 0.000 R8726 G1 225.01 N 5 151063142 M301K A T missense Het probably benign 0.281 phenotype 03/08/2021
65 662421 UTSW Suclg2 0.000 R8726 G1 208.01 N 6 95655508 F60S A G missense Het probably damaging 1.000 phenotype 03/08/2021
66 662448 UTSW Tecpr2 0.000 R8726 G1 225.01 N 12 110938234 F887L T A missense Het possibly damaging 0.820 phenotype 03/08/2021
67 662461 UTSW Tekt4 0.091 R8726 G1 224.01 N 17 25472059 W113L G T missense Het probably damaging 0.996 phenotype 03/08/2021
68 662452 UTSW Tep1 0.000 R8726 G1 225.01 N 14 50847623 S901F G A missense Het probably damaging 0.979 phenotype 03/08/2021
69 662470 UTSW Tex11 0.130 R8726 G1 222 N X 101015585 V190I C T missense Het possibly damaging 0.819 phenotype 03/08/2021
70 662407 UTSW Thbs1 0.000 R8726 G1 225.01 N 2 118119476 T A critical splice donor site 2 bp Het probably null phenotype 03/08/2021
71 662408 UTSW Tm9sf4 0.000 R8726 G1 225.01 N 2 153198375 V425D T A missense Het probably damaging 0.994 phenotype 03/08/2021
72 662447 UTSW Tpo 0.474 R8726 G1 225.01 N 12 30055138 L911P A G missense Het possibly damaging 0.953 phenotype 03/08/2021
73 662403 UTSW Ttn 1.000 R8726 G1 225.01 N 2 76898957 Q5332R T C missense Het unknown phenotype 03/08/2021
74 662431 UTSW Wdr59 1.000 R8726 G1 225.01 N 8 111496834 D169E A T missense Het 03/08/2021
75 662462 UTSW Zfp799 0.089 R8726 G1 225.01 N 17 32820192 G367C C A missense Het probably damaging 1.000 03/08/2021
[records 1 to 75 of 75]