Incidental Mutations

62 incidental mutations are currently displayed, and affect 55 genes.
7 are Possibly Damaging.
14 are Probably Damaging.
30 are Probably Benign.
7 are Probably Null.
0 create premature stop codons.
3 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 62 of 62] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 602593 UTSW AI837181 0.000 RF002 G1 154.47 N 19 5425234 (GRCm38) CGG CGGTGG small insertion Het probably benign 2019-12-04
2 602594 UTSW AI837181 0.000 RF002 G1 156.47 N 19 5425235 (GRCm38) GGC GGCTGC small insertion Het probably benign 2019-12-04
3 602539 UTSW Angptl1 0.085 RF002 G1 225.01 N 1 156857224 (GRCm38) Q321L A T missense Het possibly damaging 0.790 phenotype 2019-12-04
4 602582 UTSW AY358078 0.070 RF002 G1 214.46 N 14 51805593 (GRCm38) T TAGGATAATGC nonsense Het probably null 2019-12-04
5 602560 UTSW Blm 1.000 RF002 G1 217.47 N 7 80512905 (GRCm38) CCTCCTCCTCCTCCTCCTCCTCCT CCTCCTCCTCCTGCTCCTCCTCCTCCTCCTCCTCCT small insertion Het probably benign phenotype 2019-12-04
6 602561 UTSW Blm 1.000 RF002 G1 217.47 N 7 80512927 (GRCm38) CTC CTCATCCTCCTCATC small insertion Het probably benign phenotype 2019-12-04
7 602546 UTSW Car13 0.000 RF002 G1 225.01 N 3 14654914 (GRCm38) Y129H T C missense Het probably damaging 0.989 phenotype 2019-12-04
8 602568 UTSW Cd109 0.000 RF002 G1 217.47 N 9 78712523 (GRCm38) TTATTTATTTAT TTATTTATTTATGTATTTATTTAT critical splice acceptor site Het probably benign phenotype 2019-12-04
9 602569 UTSW Cd109 0.000 RF002 G1 217.47 N 9 78712528 (GRCm38) TATTTAT TATTTATTTATTCATTTAT critical splice acceptor site Het probably benign phenotype 2019-12-04
10 602545 UTSW Cdh26 0.000 RF002 G1 225.01 N 2 178466631 (GRCm38) C341R T C missense Het probably damaging 1.000 phenotype 2019-12-04
11 602576 UTSW Chga 0.063 RF002 G1 189.47 N 12 102561421 (GRCm38) GCA GCACCA small insertion Het probably benign phenotype 2019-12-04
12 602549 UTSW Col11a1 0.897 RF002 G1 225.01 N 3 114217001 (GRCm38) I1689L A T missense Het unknown phenotype 2019-12-04
13 602555 UTSW Dnah6 0.123 RF002 G1 225.01 N 6 73101889 (GRCm38) S2364R T G missense Het probably benign 0.000 phenotype 2019-12-04
14 602588 UTSW E4f1 1.000 RF002 G1 169.47 N 17 24455186 (GRCm38) CCG CCGACG unclassified Het probably benign phenotype 2019-12-04
15 602562 UTSW Fah 1.000 RF002 G1 225.01 N 7 84589628 (GRCm38) N336K A C missense Het probably damaging 0.997 phenotype 2019-12-04
16 602559 UTSW Fam71e1 0.122 RF002 G1 217.47 N 7 44500520 (GRCm38) CCTGGGTCTGAGGGAGGA CCTGGGTCTGAGGGAGGAAGGCTGGATCCTGGATAACTGGGTCTGAGGGAGGA nonsense Het probably null 2019-12-04
17 602592 UTSW Fbxo11 1.000 RF002 G1 225.01 N 17 87996053 (GRCm38) I664K A T missense Het phenotype 2019-12-04
18 602558 UTSW Fcgbp 0.000 RF002 G1 225.01 N 7 28089755 (GRCm38) D582G A G missense Het probably benign 0.000 2019-12-04
19 602597 UTSW Gabre RF002 G1 211.46 N X 72270057 (GRCm38) C CCGGCTA nonsense Het probably null 2019-12-04
20 602567 UTSW Gm1110 0.072 RF002 G1 225.01 N 9 26920640 (GRCm38) Y72H A G missense Het probably damaging 1.000 2019-12-04
21 602543 UTSW Gm14025 0.062 RF002 G1 225.01 N 2 129038794 (GRCm38) F404S A G missense Het 2019-12-04
22 602541 UTSW Inpp5e 1.000 RF002 G1 225.01 N 2 26408377 (GRCm38) A71T C T missense Het possibly damaging 0.951 phenotype 2019-12-04
23 602565 UTSW Iqcm 0.059 RF002 G1 225.01 N 8 75577899 (GRCm38) T96I C T missense Het probably benign 0.006 2019-12-04
24 602547 UTSW Lce1m RF002 G1 217.47 N 3 93018283 (GRCm38) TGCCACCGCTGC TGCCACCGCTGCCGCCACCGCTGC unclassified Het probably benign 2019-12-04
25 602548 UTSW Lce1m RF002 G1 217.47 N 3 93018299 (GRCm38) AC ACCGCCGCTGCCCC unclassified Het probably benign 2019-12-04
26 602584 UTSW Lrch1 0.000 RF002 G1 214.46 N 14 74947574 (GRCm38) TTGGTGGTGCTGGTGG TTGGTGG small deletion Het probably benign phenotype 2019-12-04
27 602577 UTSW Lyst 0.300 RF002 G1 225.01 N 13 13634363 (GRCm38) D206G A G missense Het probably benign 0.055 phenotype 2019-12-04
28 602575 UTSW Map4k5 0.000 RF002 G1 225.01 N 12 69856856 (GRCm38) D58E A T missense Het probably damaging 0.957 phenotype 2019-12-04
29 602538 UTSW Mapkapk2 0.000 RF002 G1 225.01 N 1 131056513 (GRCm38) S251P A G missense Het probably damaging 1.000 phenotype 2019-12-04
30 602563 UTSW Mcph1 0.000 RF002 G1 139.47 N 8 18652529 (GRCm38) CCTG CCTGCTG small insertion Het probably benign phenotype 2019-12-04
31 602595 UTSW Men1 1.000 RF002 G1 225.01 N 19 6340116 (GRCm38) S600P T C missense Het probably damaging 0.966 phenotype 2019-12-04
32 602590 UTSW Mllt1 1.000 RF002 G1 225.01 N 17 56896300 (GRCm38) V394M C T missense Het probably benign 0.088 phenotype 2019-12-04
33 602591 UTSW Mllt1 1.000 RF002 G1 225.01 N 17 56896301 (GRCm38) M393I C A missense Het possibly damaging 0.656 phenotype 2019-12-04
34 602566 UTSW Nacc1 0.000 RF002 G1 225.01 N 8 84676219 (GRCm38) E315G T C missense Het possibly damaging 0.504 phenotype 2019-12-04
35 602570 UTSW Nefh 0.000 RF002 G1 217.47 N 11 4941047 (GRCm38) GGGGACTTGGCCTC GGGGACTTGGCCTCACCTAGGGACTTGGCCTC small insertion Het probably benign phenotype 2019-12-04
36 602571 UTSW Nefh 0.000 RF002 G1 214.46 N 11 4941050 (GRCm38) GACTTGGCCTC GACTTGGCCTCACCTGGGGACTTGGCCTC small insertion Het probably benign phenotype 2019-12-04
37 602579 UTSW Nid2 0.188 RF002 G1 214.46 N 14 19751366 (GRCm38) TAACACCGCCA TA small deletion Het probably benign phenotype 2019-12-04
38 602596 UTSW Olfr1484 0.085 RF002 G1 225.01 N 19 13586051 (GRCm38) I206N T A missense Het probably damaging 0.997 phenotype 2019-12-04
39 602581 UTSW Parp2 0.345 RF002 G1 225.01 N 14 50817386 (GRCm38) E262G A G missense Het probably damaging 0.998 phenotype 2019-12-04
40 602551 UTSW Pdik1l 0.000 RF002 G1 214.46 N 4 134279375 (GRCm38) TTT TTTGTTTTTGTGTT frame shift Het probably null 2019-12-04
41 602585 UTSW Pop1 0.958 RF002 G1 225.01 N 15 34502437 (GRCm38) G90D G A missense Het probably damaging 0.999 phenotype 2019-12-04
42 602583 UTSW Ppp3cc 0.000 RF002 G1 225.01 N 14 70267339 (GRCm38) T73A T C missense Het possibly damaging 0.516 phenotype 2019-12-04
43 602587 UTSW Prdm15 0.000 RF002 G1 225.01 N 16 97799629 (GRCm38) D810N C T missense Het probably damaging 1.000 2019-12-04
44 602578 UTSW Prpf4b 1.000 RF002 G1 225.01 N 13 34884236 (GRCm38) S349R T A missense Het unknown phenotype 2019-12-04
45 602553 UTSW Rassf6 0.083 RF002 G1 140.47 N 5 90608921 (GRCm38) TCCTGTAGAGCAATGGGGATTC TCCTGTAGAGCAATGGGGATTCTGCCTCACTCATGGGCCTGTAGAGCAATGGGGATTC utr 3 prime Het probably benign phenotype 2019-12-04
46 602554 UTSW Rassf6 0.083 RF002 G1 138.47 N 5 90608925 (GRCm38) GTAGAGCAATGGGGATTC GTAGAGCAATGGGGATTCTGCCTCACTCATGGTCCTTTAGAGCAATGGGGATTC nonsense Het probably null phenotype 2019-12-04
47 602574 UTSW Sdk2 0.102 RF002 G1 225.01 N 11 113885252 (GRCm38) E208G T C missense Het probably benign 0.004 phenotype 2019-12-04
48 602573 UTSW Smurf2 0.000 RF002 G1 225.01 N 11 106852587 (GRCm38) P211Q G T missense Het probably benign 0.220 phenotype 2019-12-04
49 602564 UTSW Snx25 1.000 RF002 G1 225.01 N 8 46116181 (GRCm38) C A critical splice donor site 1 bp Het probably null 2019-12-04
50 602550 UTSW Spata6 0.000 RF002 G1 225.01 N 4 111828305 (GRCm38) M469K T A missense Het probably benign 0.000 phenotype 2019-12-04
51 602540 UTSW Spta1 0.826 RF002 G1 225.01 N 1 174231360 (GRCm38) A1954S G T missense Het possibly damaging 0.623 phenotype 2019-12-04
52 602599 UTSW Sry 0.318 RF002 G1 217.47 N Y 2662564 (GRCm38) CTGGTCGTGGAACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGGTGGTGGTCATGGAACTGCTG CTGGTCATGGAACTGCTG small deletion Het probably benign phenotype 2019-12-04
53 602598 UTSW Stard8 0.000 RF002 G1 161.47 N X 99066515 (GRCm38) GAG GAGTAG nonsense Het probably null phenotype 2019-12-04
54 602589 UTSW Tfeb 1.000 RF002 G1 161.47 N 17 47786102 (GRCm38) AGC AGCGGC small insertion Het probably benign phenotype 2019-12-04
55 602572 UTSW Tlcd1 0.117 RF002 G1 225.01 N 11 78180194 (GRCm38) L203Q T A missense Het probably benign 0.006 2019-12-04
56 602580 UTSW Tlr11 0.000 RF002 G1 225.01 N 14 50361225 (GRCm38) F223L T C missense Het possibly damaging 0.625 2019-12-04
57 602552 UTSW Usp48 0.961 RF002 G1 225.01 N 4 137605795 (GRCm38) V100D T A missense Het probably damaging 1.000 phenotype 2019-12-04
58 602557 UTSW Vmn2r56 0.064 RF002 G1 91.01 N 7 12694830 (GRCm38) T503I G A missense Het probably benign 0.018 2019-12-04
59 602542 UTSW Vps18 1.000 RF002 G1 225.01 N 2 119297390 (GRCm38) L898P T C missense Het probably damaging 1.000 phenotype 2019-12-04
60 602556 UTSW Zfp384 0.172 RF002 G1 217.47 N 6 125036471 (GRCm38) GCCCAGGCCCAGGCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAGGCCCAGGCCCAG unclassified Het probably benign phenotype 2019-12-04
61 602586 UTSW Zfp706 0.393 RF002 G1 225.01 N 15 37003705 (GRCm38) Y39F T A missense Het probably benign 0.148 2019-12-04
62 602544 UTSW Zhx3 1.000 RF002 G1 225.01 N 2 160781806 (GRCm38) N147I T A missense Het probably damaging 0.983 phenotype 2019-12-04
[records 1 to 62 of 62]