Incidental Mutations

73 incidental mutations are currently displayed, and affect 69 genes.
7 are Possibly Damaging.
17 are Probably Damaging.
34 are Probably Benign.
12 are Probably Null.
4 create premature stop codons.
3 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 73 of 73] per page Full List
ID question?
Source question?
Gene question?
E-score question?
Stock # question?
Gen question?
Vld question?
Strain question?
Chr question?
Position question?
Mutation question?
Type question?
Exon Dist question?
Zygosity question?
Predicted Effect question?
PPH Score question?
Meta Score question?
MGI Phenotype question?
Posted question?
1 602626 UTSW 4930433I11Rik 0.069 RF003 G1 167.47 N 7 40993055 AACC A small deletion Het probably benign 12/04/2019
2 602623 UTSW A630073D07Rik 0.067 RF003 G1 225.01 N 6 132627443 L13R A C missense Het unknown 12/04/2019
3 602636 UTSW Alg9 1.000 RF003 G1 180.98 N 9 50775427 GGC GGCCGC unclassified Het probably benign phenotype 12/04/2019
4 602657 UTSW Arc 1.000 RF003 G1 225.01 N 15 74672131 T81S G C missense Het probably benign 0.003 phenotype 12/04/2019
5 602646 UTSW Atad5 1.000 RF003 G1 225.01 N 11 80111560 K1059N A T missense Het probably damaging 0.989 phenotype 12/04/2019
6 602651 UTSW Bdp1 1.000 RF003 G1 225.01 N 13 100060449 V1143F C A missense Het probably benign 0.306 phenotype 12/04/2019
7 602652 UTSW Bdp1 1.000 RF003 G1 225.01 N 13 100060450 Q1142H C A missense Het probably benign 0.306 phenotype 12/04/2019
8 602637 UTSW Ccdc33 0.000 RF003 G1 225.01 N 9 58058291 S583G T C missense Het probably benign 0.177 12/04/2019
9 602638 UTSW Cd109 0.000 RF003 G1 217.47 N 9 78712531 TTAT TTATTTATTTATATAT critical splice acceptor site Het probably benign phenotype 12/04/2019
10 602667 UTSW Cep192 0.000 RF003 G1 225.01 N 18 67837956 R1009S A T missense Het probably benign 0.444 12/04/2019
11 602641 UTSW Clvs2 0.109 RF003 G1 225.01 N 10 33622925 H3L T A missense Het probably damaging 0.963 phenotype 12/04/2019
12 602644 UTSW Cnot6 0.533 RF003 G1 225.01 N 11 49702613 M14V T C missense Het probably benign 0.011 phenotype 12/04/2019
13 602656 UTSW Colec10 0.000 RF003 G1 225.01 N 15 54462391 R206G A G missense Het possibly damaging 0.505 phenotype 12/04/2019
14 602653 UTSW Dennd6a 0.216 RF003 G1 225.01 N 14 26629534 I598T T C missense Het probably damaging 0.994 12/04/2019
15 602669 UTSW Dmrt2 1.000 RF003 G1 225.01 N 19 25678134 S366P T C missense Het probably damaging 0.998 phenotype 12/04/2019
16 602635 UTSW Dnmt1 1.000 RF003 G1 217.47 N 9 20910131 AGTTCCTACCTCGTT AGTTCCTACCTCGTTTTGGGGGCGGAGCACCGTTCCTACCTCGTT nonsense Het probably null phenotype 12/04/2019
17 602664 UTSW Efhb 0.086 RF003 G1 225.01 N 17 53400891 D748G T C missense Het probably damaging 1.000 12/04/2019
18 602604 UTSW Etl4 0.794 RF003 G1 225.01 N 2 20519918 Q21* C T nonsense Het probably null phenotype 12/04/2019
19 602649 UTSW Fam172a 0.162 RF003 G1 225.01 N 13 77834675 I135L A T missense Het possibly damaging 0.930 12/04/2019
20 602627 UTSW Fam71e1 0.087 RF003 G1 217.47 N 7 44500527 C CGGAGGGAGGAAGGCTGGATCCTGGATACCTGGGTA frame shift Het probably null 12/04/2019
21 602660 UTSW Flywch1 1.000 RF003 G1 217.47 N 17 23762166 CCACTCCTGGTGT CCACTCCTGGTGTGGGGAGGCTACGTACTCACACACTCCTGGTGT frame shift Het probably null 12/04/2019
22 602606 UTSW Fmn1 0.358 RF003 G1 217.47 N 2 113525786 ACCTCC ACCTCCCCCTCC small insertion Het probably benign phenotype 12/04/2019
23 602605 UTSW Fsip2 0.116 RF003 G1 219.01 N 2 82991521 M5866K T A missense Het probably benign 0.024 phenotype 12/04/2019
24 602671 UTSW Gab3 0.000 RF003 G1 125.47 N X 75000006 CTT CTTATT nonsense Het probably null phenotype 12/04/2019
25 602611 UTSW Gnl2 0.964 RF003 G1 225.01 N 4 125043725 T A critical splice donor site 2 bp Het probably null 12/04/2019
26 602619 UTSW Grip2 0.000 RF003 G1 225.01 N 6 91783593 R341Q C T missense Het probably benign 0.021 phenotype 12/04/2019
27 602602 UTSW Hmcn1 0.000 RF003 G1 225.01 N 1 150624561 H3960L T A missense Het probably damaging 1.000 phenotype 12/04/2019
28 602616 UTSW Igkv6-25 0.294 RF003 G1 225.01 N 6 70215778 Y56* T A nonsense Het probably null 0.976 12/04/2019
29 602610 UTSW Il12a 0.000 RF003 G1 225.01 N 3 68695229 T102S A T missense Het probably benign 0.003 phenotype 12/04/2019
30 602609 UTSW Il1a 0.000 RF003 G1 225.01 N 2 129302932 I189F T A missense Het possibly damaging 0.564 phenotype 12/04/2019
31 602633 UTSW Inpp4b 0.255 RF003 G1 109.01 N 8 81969521 Y361* T A nonsense Het probably null phenotype 12/04/2019
32 602639 UTSW Iqcf4 0.052 RF003 G1 182.47 N 9 106570607 CTTTTCCTTTTCCTTTT CTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCATTTTCCTTTTCCTTTT small insertion Het probably benign 12/04/2019
34 602672 UTSW Las1l RF003 G1 203.47 N X 95940816 AGTGG AGTGGTGG small insertion Het probably benign 12/04/2019
35 602624 UTSW Lrmp 0.000 RF003 G1 214.46 N 6 145173783 AGCACATTG AGCACATTGTGCACATTG unclassified Het probably benign phenotype 12/04/2019
36 602613 UTSW Lrrc8d 0.000 RF003 G1 225.01 N 5 105812641 Y306H T C missense Het probably damaging 1.000 12/04/2019
37 602670 UTSW Mamld1 RF003 G1 142.47 N X 71118820 AGC AGCCGC small insertion Het probably benign phenotype 12/04/2019
38 602608 UTSW Map1a 0.343 RF003 G1 217.47 N 2 121306296 CTCCAGCTCCAGCTCCAGCTCCA CTCCAGCTCCAGCTCCAGCTCCAGCTCCAGATCCAGCTCCAGCTCCAGCTCCA small insertion Het probably benign phenotype 12/04/2019
39 602650 UTSW Map1b 1.000 RF003 G1 225.01 N 13 99430750 A1821E G T missense Het unknown phenotype 12/04/2019
40 602632 UTSW Maz 0.589 RF003 G1 225.01 N 7 127025497 C284R A G missense Het probably damaging 1.000 12/04/2019
41 602640 UTSW Med23 1.000 RF003 G1 224.01 N 10 24903785 H920R A G missense Het probably damaging 1.000 phenotype 12/04/2019
42 602666 UTSW Megf10 0.531 RF003 G1 121.47 N 18 57294027 CCAGCAGCAGCAGCAGCAGCAG CCAGCAGCAGCAGCAGCAG unclassified Het probably benign phenotype 12/04/2019
43 602654 UTSW Mmp14 0.924 RF003 G1 225.01 N 14 54439014 R339* C T nonsense Het probably null phenotype 12/04/2019
44 602603 UTSW Mroh9 0.000 RF003 G1 225.01 N 1 163058061 K334T T G missense Het probably damaging 1.000 12/04/2019
45 602601 UTSW Nab1 0.000 RF003 G1 225.01 N 1 52479282 C320S A T missense Het probably damaging 0.999 phenotype 12/04/2019
46 602618 UTSW Noto 0.158 RF003 G1 225.01 N 6 85424210 S74P T C missense Het probably benign 0.009 phenotype 12/04/2019
47 602643 UTSW Nudt4 0.907 RF003 G1 225.01 N 10 95549374 N152D T C missense Het possibly damaging 0.718 phenotype 12/04/2019
48 602655 UTSW Nup155 1.000 RF003 G1 156.47 N 15 8119176 T TTTTG critical splice acceptor site Het probably benign phenotype 12/04/2019
49 602607 UTSW Nusap1 1.000 RF003 G1 182.47 N 2 119627603 AGCTGAGA AGCTGAGATACACGTTAGCAGTGAGGAGCAGGCTGAGA small insertion Het probably benign phenotype 12/04/2019
50 602662 UTSW Olfr118 0.063 RF003 G1 225.01 N 17 37672858 K278N A C missense Het probably damaging 0.998 phenotype 12/04/2019
51 602645 UTSW Olfr330 0.053 RF003 G1 214.46 N 11 58529157 CA C frame shift Het probably null phenotype 12/04/2019
52 602615 UTSW Olfr461 0.079 RF003 G1 225.01 N 6 40544362 I206V T C missense Het probably benign 0.014 phenotype 12/04/2019
53 602629 UTSW Olfr585 0.054 RF003 G1 214.46 N 7 103098305 GTTAT GTTATTAT Het phenotype 12/04/2019
54 602630 UTSW Olfr585 0.054 RF003 G1 214.46 N 7 103098306 TTA TTAGTA nonsense Het probably null phenotype 12/04/2019
55 602631 UTSW Olfr710 0.056 RF003 G1 225.01 N 7 106944648 M118L T A missense Het probably damaging 0.999 phenotype 12/04/2019
56 602634 UTSW Olfr828 0.136 RF003 G1 225.01 N 9 18815482 T271A T C missense Het probably benign 0.026 phenotype 12/04/2019
57 602642 UTSW Plxnc1 0.372 RF003 G1 225.01 N 10 94794444 Y1531C T C missense Het probably damaging 1.000 phenotype 12/04/2019
58 602625 UTSW Pnmal2 0.052 RF003 G1 148.47 N 7 16946016 TGA TGAAGA small insertion Het probably benign 12/04/2019
59 602600 UTSW Rp1 0.099 RF003 G1 225.01 N 1 4344694 V2065A A G missense Het probably damaging 0.987 phenotype 12/04/2019
60 602661 UTSW Sbp 0.077 RF003 G1 217.47 N 17 23945369 AAGATGCTGACAACA AAGATGCTGACAACAGAGATGCTGACAACA small insertion Het probably benign 12/04/2019
61 602612 UTSW Sepsecs 0.966 RF003 G1 225.01 N 5 52647191 T379M G A missense Het probably benign 0.038 phenotype 12/04/2019
62 602614 UTSW Sfswap 0.000 RF003 G1 217.49 N 5 129569764 GGCC GGCCCACTCTGCC unclassified Het probably benign phenotype 12/04/2019
63 602665 UTSW Six3 1.000 RF003 G1 154.47 N 17 85621370 GCG GCGTCG small insertion Het probably benign phenotype 12/04/2019
64 602663 UTSW Tfeb 1.000 RF003 G1 225.01 N 17 47788078 T259I C T missense Het possibly damaging 0.861 phenotype 12/04/2019
65 602617 UTSW Tgoln1 0.134 RF003 G1 112.66 N 6 72616352 A AAACTCAG nonsense Het probably null 12/04/2019
66 602647 UTSW Tmem94 0.255 RF003 G1 225.01 N 11 115796132 V1108M G A missense Het probably damaging 1.000 12/04/2019
67 602628 UTSW Usp35 0.099 RF003 G1 225.01 N 7 97322096 K297E T C missense Het possibly damaging 0.876 12/04/2019
68 602648 UTSW Vcpkmt 0.000 RF003 G1 225.01 N 12 69582824 T55S T A missense Het possibly damaging 0.481 phenotype 12/04/2019
69 602620 UTSW Zfp384 0.186 RF003 G1 217.47 N 6 125036471 GCCCAGGCCCAGGCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAGGCCCAGGCCCAG unclassified Het probably benign phenotype 12/04/2019
70 602621 UTSW Zfp384 0.186 RF003 G1 217.47 N 6 125036476 GGCCC GGCCCTGGCCCAAGCCC unclassified Het probably benign phenotype 12/04/2019
71 602622 UTSW Zfp384 0.186 RF003 G1 218 N 6 125036483 GCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAG unclassified Het probably benign phenotype 12/04/2019
72 602668 UTSW Zfp407 1.000 RF003 G1 225.01 N 18 84209563 S1974T A T missense Het probably benign 0.165 phenotype 12/04/2019
73 602659 UTSW Zfp677 0.154 RF003 G1 225.01 N 17 21397442 S254P T C missense Het probably damaging 0.999 12/04/2019
[records 1 to 73 of 73]