Incidental Mutations

73 incidental mutations are currently displayed, and affect 69 genes.
7 are Possibly Damaging.
17 are Probably Damaging.
34 are Probably Benign.
12 are Probably Null.
4 create premature stop codons.
3 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 73 of 73] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 602626 UTSW 4930433I11Rik 0.077 RF003 G1 167.47 N 7 40993055 AACC A small deletion Het probably benign 12/04/2019
2 602623 UTSW A630073D07Rik 0.106 RF003 G1 225.01 N 6 132627443 L13R A C missense Het unknown 12/04/2019
3 602636 UTSW Alg9 1.000 RF003 G1 180.98 N 9 50775427 GGC GGCCGC unclassified Het probably benign phenotype 12/04/2019
4 602657 UTSW Arc 1.000 RF003 G1 225.01 N 15 74672131 T81S G C missense Het probably benign 0.003 phenotype 12/04/2019
5 602646 UTSW Atad5 1.000 RF003 G1 225.01 N 11 80111560 K1059N A T missense Het probably damaging 0.989 phenotype 12/04/2019
6 602651 UTSW Bdp1 1.000 RF003 G1 225.01 N 13 100060449 V1143F C A missense Het probably benign 0.306 phenotype 12/04/2019
7 602652 UTSW Bdp1 1.000 RF003 G1 225.01 N 13 100060450 Q1142H C A missense Het probably benign 0.306 phenotype 12/04/2019
8 602637 UTSW Ccdc33 0.000 RF003 G1 225.01 N 9 58058291 S583G T C missense Het probably benign 0.177 12/04/2019
9 602638 UTSW Cd109 0.000 RF003 G1 217.47 N 9 78712531 TTAT TTATTTATTTATATAT critical splice acceptor site Het probably benign phenotype 12/04/2019
10 602667 UTSW Cep192 0.000 RF003 G1 225.01 N 18 67837956 R1009S A T missense Het probably benign 0.444 12/04/2019
11 602641 UTSW Clvs2 0.102 RF003 G1 225.01 N 10 33622925 H3L T A missense Het probably damaging 0.963 phenotype 12/04/2019
12 602644 UTSW Cnot6 0.264 RF003 G1 225.01 N 11 49702613 M14V T C missense Het probably benign 0.011 phenotype 12/04/2019
13 602656 UTSW Colec10 0.000 RF003 G1 225.01 N 15 54462391 R206G A G missense Het possibly damaging 0.505 phenotype 12/04/2019
14 602653 UTSW Dennd6a 0.215 RF003 G1 225.01 N 14 26629534 I598T T C missense Het probably damaging 0.994 12/04/2019
15 602669 UTSW Dmrt2 1.000 RF003 G1 225.01 N 19 25678134 S366P T C missense Het probably damaging 0.998 phenotype 12/04/2019
16 602635 UTSW Dnmt1 1.000 RF003 G1 217.47 N 9 20910131 AGTTCCTACCTCGTT AGTTCCTACCTCGTTTTGGGGGCGGAGCACCGTTCCTACCTCGTT nonsense Het probably null phenotype 12/04/2019
17 602664 UTSW Efhb 0.116 RF003 G1 225.01 N 17 53400891 D748G T C missense Het probably damaging 1.000 12/04/2019
18 602604 UTSW Etl4 0.650 RF003 G1 225.01 N 2 20519918 Q21* C T nonsense Het probably null phenotype 12/04/2019
19 602649 UTSW Fam172a 0.166 RF003 G1 225.01 N 13 77834675 I135L A T missense Het possibly damaging 0.930 12/04/2019
20 602627 UTSW Fam71e1 0.132 RF003 G1 217.47 N 7 44500527 C CGGAGGGAGGAAGGCTGGATCCTGGATACCTGGGTA frame shift Het probably null 12/04/2019
21 602660 UTSW Flywch1 1.000 RF003 G1 217.47 N 17 23762166 CCACTCCTGGTGT CCACTCCTGGTGTGGGGAGGCTACGTACTCACACACTCCTGGTGT frame shift Het probably null 12/04/2019
22 602606 UTSW Fmn1 0.298 RF003 G1 217.47 N 2 113525786 ACCTCC ACCTCCCCCTCC small insertion Het probably benign phenotype 12/04/2019
23 602605 UTSW Fsip2 0.110 RF003 G1 219.01 N 2 82991521 M5866K T A missense Het probably benign 0.024 phenotype 12/04/2019
24 602671 UTSW Gab3 0.000 RF003 G1 125.47 N X 75000006 CTT CTTATT nonsense Het probably null phenotype 12/04/2019
25 602611 UTSW Gnl2 0.958 RF003 G1 225.01 N 4 125043725 T A critical splice donor site 2 bp Het probably null 12/04/2019
26 602619 UTSW Grip2 0.000 RF003 G1 225.01 N 6 91783593 R341Q C T missense Het probably benign 0.021 phenotype 12/04/2019
27 602602 UTSW Hmcn1 0.000 RF003 G1 225.01 N 1 150624561 H3960L T A missense Het probably damaging 1.000 phenotype 12/04/2019
28 602616 UTSW Igkv6-25 0.412 RF003 G1 225.01 N 6 70215778 Y56* T A nonsense Het probably null 0.976 12/04/2019
29 602610 UTSW Il12a 0.000 RF003 G1 225.01 N 3 68695229 T102S A T missense Het probably benign 0.003 phenotype 12/04/2019
30 602609 UTSW Il1a 0.000 RF003 G1 225.01 N 2 129302932 I189F T A missense Het possibly damaging 0.564 phenotype 12/04/2019
31 602633 UTSW Inpp4b 0.351 RF003 G1 109.01 N 8 81969521 Y361* T A nonsense Het probably null phenotype 12/04/2019
32 602639 UTSW Iqcf4 0.056 RF003 G1 182.47 N 9 106570607 CTTTTCCTTTTCCTTTT CTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCATTTTCCTTTTCCTTTT small insertion Het probably benign 12/04/2019
33 602658 UTSW Krt1 0.268 RF003 G1 214.46 N 15 101850378 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC small deletion Het probably benign 0.090 phenotype 12/04/2019
34 602672 UTSW Las1l RF003 G1 203.47 N X 95940816 AGTGG AGTGGTGG small insertion Het probably benign 12/04/2019
35 602624 UTSW Lrmp 0.000 RF003 G1 214.46 N 6 145173783 AGCACATTG AGCACATTGTGCACATTG unclassified Het probably benign phenotype 12/04/2019
36 602613 UTSW Lrrc8d 0.000 RF003 G1 225.01 N 5 105812641 Y306H T C missense Het probably damaging 1.000 12/04/2019
37 602670 UTSW Mamld1 RF003 G1 142.47 N X 71118820 AGC AGCCGC small insertion Het probably benign phenotype 12/04/2019
38 602608 UTSW Map1a 0.566 RF003 G1 217.47 N 2 121306296 CTCCAGCTCCAGCTCCAGCTCCA CTCCAGCTCCAGCTCCAGCTCCAGCTCCAGATCCAGCTCCAGCTCCAGCTCCA small insertion Het probably benign phenotype 12/04/2019
39 602650 UTSW Map1b 1.000 RF003 G1 225.01 N 13 99430750 A1821E G T missense Het unknown phenotype 12/04/2019
40 602632 UTSW Maz 0.431 RF003 G1 225.01 N 7 127025497 C284R A G missense Het probably damaging 1.000 12/04/2019
41 602640 UTSW Med23 1.000 RF003 G1 224.01 N 10 24903785 H920R A G missense Het probably damaging 1.000 phenotype 12/04/2019
42 602666 UTSW Megf10 0.446 RF003 G1 121.47 N 18 57294027 CCAGCAGCAGCAGCAGCAGCAG CCAGCAGCAGCAGCAGCAG unclassified Het probably benign phenotype 12/04/2019
43 602654 UTSW Mmp14 0.920 RF003 G1 225.01 N 14 54439014 R339* C T nonsense Het probably null phenotype 12/04/2019
44 602603 UTSW Mroh9 0.000 RF003 G1 225.01 N 1 163058061 K334T T G missense Het probably damaging 1.000 12/04/2019
45 602601 UTSW Nab1 0.000 RF003 G1 225.01 N 1 52479282 C320S A T missense Het probably damaging 0.999 phenotype 12/04/2019
46 602618 UTSW Noto 0.376 RF003 G1 225.01 N 6 85424210 S74P T C missense Het probably benign 0.009 phenotype 12/04/2019
47 602643 UTSW Nudt4 0.921 RF003 G1 225.01 N 10 95549374 N152D T C missense Het possibly damaging 0.718 phenotype 12/04/2019
48 602655 UTSW Nup155 1.000 RF003 G1 156.47 N 15 8119176 T TTTTG critical splice acceptor site Het probably benign phenotype 12/04/2019
49 602607 UTSW Nusap1 1.000 RF003 G1 182.47 N 2 119627603 AGCTGAGA AGCTGAGATACACGTTAGCAGTGAGGAGCAGGCTGAGA small insertion Het probably benign phenotype 12/04/2019
50 602662 UTSW Olfr118 0.084 RF003 G1 225.01 N 17 37672858 K278N A C missense Het probably damaging 0.998 phenotype 12/04/2019
51 602645 UTSW Olfr330 0.067 RF003 G1 214.46 N 11 58529157 CA C frame shift Het probably null phenotype 12/04/2019
52 602615 UTSW Olfr461 0.077 RF003 G1 225.01 N 6 40544362 I206V T C missense Het probably benign 0.014 phenotype 12/04/2019
53 602629 UTSW Olfr585 0.064 RF003 G1 214.46 N 7 103098305 GTTAT GTTATTAT Het phenotype 12/04/2019
54 602630 UTSW Olfr585 0.064 RF003 G1 214.46 N 7 103098306 TTA TTAGTA nonsense Het probably null phenotype 12/04/2019
55 602631 UTSW Olfr710 0.099 RF003 G1 225.01 N 7 106944648 M118L T A missense Het probably damaging 0.999 phenotype 12/04/2019
56 602634 UTSW Olfr828 0.136 RF003 G1 225.01 N 9 18815482 T271A T C missense Het probably benign 0.026 phenotype 12/04/2019
57 602642 UTSW Plxnc1 0.370 RF003 G1 225.01 N 10 94794444 Y1531C T C missense Het probably damaging 1.000 phenotype 12/04/2019
58 602625 UTSW Pnmal2 0.059 RF003 G1 148.47 N 7 16946016 TGA TGAAGA small insertion Het probably benign 12/04/2019
59 602600 UTSW Rp1 0.091 RF003 G1 225.01 N 1 4344694 V2065A A G missense Het probably damaging 0.987 phenotype 12/04/2019
60 602661 UTSW Sbp 0.057 RF003 G1 217.47 N 17 23945369 AAGATGCTGACAACA AAGATGCTGACAACAGAGATGCTGACAACA small insertion Het probably benign 12/04/2019
61 602612 UTSW Sepsecs 0.966 RF003 G1 225.01 N 5 52647191 T379M G A missense Het probably benign 0.038 phenotype 12/04/2019
62 602614 UTSW Sfswap 0.000 RF003 G1 217.49 N 5 129569764 GGCC GGCCCACTCTGCC unclassified Het probably benign phenotype 12/04/2019
63 602665 UTSW Six3 1.000 RF003 G1 154.47 N 17 85621370 GCG GCGTCG small insertion Het probably benign phenotype 12/04/2019
64 602663 UTSW Tfeb 1.000 RF003 G1 225.01 N 17 47788078 T259I C T missense Het possibly damaging 0.861 phenotype 12/04/2019
65 602617 UTSW Tgoln1 0.123 RF003 G1 112.66 N 6 72616352 A AAACTCAG nonsense Het probably null 12/04/2019
66 602647 UTSW Tmem94 0.153 RF003 G1 225.01 N 11 115796132 V1108M G A missense Het probably damaging 1.000 12/04/2019
67 602628 UTSW Usp35 0.135 RF003 G1 225.01 N 7 97322096 K297E T C missense Het possibly damaging 0.876 12/04/2019
68 602648 UTSW Vcpkmt 0.000 RF003 G1 225.01 N 12 69582824 T55S T A missense Het possibly damaging 0.481 phenotype 12/04/2019
69 602620 UTSW Zfp384 0.191 RF003 G1 217.47 N 6 125036471 GCCCAGGCCCAGGCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAGGCCCAGGCCCAG unclassified Het probably benign phenotype 12/04/2019
70 602621 UTSW Zfp384 0.191 RF003 G1 217.47 N 6 125036476 GGCCC GGCCCTGGCCCAAGCCC unclassified Het probably benign phenotype 12/04/2019
71 602622 UTSW Zfp384 0.191 RF003 G1 218 N 6 125036483 GCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAG unclassified Het probably benign phenotype 12/04/2019
72 602668 UTSW Zfp407 1.000 RF003 G1 225.01 N 18 84209563 S1974T A T missense Het probably benign 0.165 phenotype 12/04/2019
73 602659 UTSW Zfp677 0.097 RF003 G1 225.01 N 17 21397442 S254P T C missense Het probably damaging 0.999 12/04/2019
[records 1 to 73 of 73]