Incidental Mutations

62 incidental mutations are currently displayed, and affect 60 genes.
9 are Possibly Damaging.
14 are Probably Damaging.
28 are Probably Benign.
10 are Probably Null.
3 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 62 of 62] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 602747 UTSW 5430401F13Rik 0.065 RF005 G1 167.47 N 6 131552884 AGAAAGGAAAAGGTGGCCAG AGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG small insertion Het probably benign 12/04/2019
2 602729 UTSW A030005L19Rik RF005 G1 214.46 N 1 82913585 CTGCTG CTGCTGTGGATGCTG small insertion Het probably benign 12/04/2019
3 602742 UTSW Abca1 1.000 RF005 G1 225.01 Y 4 53049125 T1651N G T missense Het probably damaging 0.974 phenotype 12/04/2019
4 602751 UTSW Adamtsl3 0.000 RF005 G1 223.01 Y 7 82612395 T40A A G missense Het 12/04/2019
5 628433 UTSW Adgra3 0.000 RF005 G1 225.01 Y 5 50013387 A T splice site 6 bp Het probably null phenotype 04/07/2020
6 602733 UTSW Apcs 0.062 RF005 G1 225.01 Y 1 172894242 M179K A T missense Het probably damaging 0.996 phenotype 12/04/2019
7 602773 UTSW Baiap2 0.148 RF005 G1 225.01 Y 11 119996529 E217K G A missense Het possibly damaging 0.894 phenotype 12/04/2019
8 602771 UTSW Ccdc69 0.000 RF005 G1 225.01 Y 11 55060523 L24P A G missense Het probably damaging 1.000 0.196 12/04/2019
9 602760 UTSW Cdh16 0.082 RF005 G1 225.01 Y 8 104617052 N604T T G missense Het probably damaging 1.000 phenotype 12/04/2019
10 602789 UTSW Cfb 0.000 RF005 G1 225.01 Y 17 34858046 V538I C T missense Het possibly damaging 0.759 phenotype 12/04/2019
11 602730 UTSW Col6a3 0.000 RF005 G1 171.01 Y 1 90811262 S1022P A G missense Het probably benign 0.001 phenotype 12/04/2019
12 602750 UTSW Cpeb1 0.000 RF005 G1 225.01 Y 7 81361806 L129S A G missense Het possibly damaging 0.785 phenotype 12/04/2019
13 602764 UTSW Crybg1 1.000 RF005 G1 225.01 Y 10 44004745 V149A A G missense Het probably benign 0.031 12/04/2019
14 628434 UTSW Cyp4f16 0.000 RF005 G1 224.01 Y 17 32545195 C A splice site 42 bp Het probably null 04/07/2020
15 602776 UTSW Dlg5 1.000 RF005 G1 225.01 Y 14 24158493 Q882* G A nonsense Het probably null phenotype 12/04/2019
16 602734 UTSW Fsip2 0.108 RF005 G1 225.01 Y 2 82992532 I6203K T A missense Het probably benign 0.035 phenotype 12/04/2019
17 602799 UTSW Gabre RF005 G1 214.59 N X 72270045 CCGGCT CCGGCTACGGCT nonsense Het probably null 12/04/2019
18 602745 UTSW Gm17660 0.071 RF005 G1 225.01 Y 5 104074859 A C critical splice donor site 2 bp Het probably null 12/04/2019
19 602762 UTSW Gm9513 0.060 RF005 G1 225.01 Y 9 36475674 S13P T C missense Het possibly damaging 0.608 12/04/2019
20 602749 UTSW Gprc5d 0.000 RF005 G1 225.01 Y 6 135116519 L130Q A T missense Het probably damaging 1.000 phenotype 12/04/2019
21 602739 UTSW H13 1.000 RF005 G1 225.01 Y 2 152669669 E30K G A missense Het probably damaging 1.000 0.411 phenotype 12/04/2019
22 602731 UTSW Hmcn1 0.000 RF005 G1 225.01 Y 1 150635146 K3609* T A nonsense Het probably null phenotype 12/04/2019
23 602743 UTSW Hsdl2 0.000 RF005 G1 218 N 4 59610652 GCTGCAG GCTGCAGCAGCAGCCACATCTGCAG small insertion Het probably benign 12/04/2019
24 602746 UTSW Kl 0.000 RF005 G1 225.01 Y 5 150953420 Y235S A C missense Het probably benign 0.072 phenotype 12/04/2019
25 602784 UTSW Map6d1 RF005 G1 225.01 Y 16 20241000 T105I G A missense Het probably benign 0.016 phenotype 12/04/2019
26 602775 UTSW Mast4 0.322 RF005 G1 214.46 N 13 102736307 GGTGGTGGTGG GGTGGTGGTGGTGGTGG small insertion Het probably benign phenotype 12/04/2019
27 602795 UTSW Mbd1 0.000 RF005 G1 217.47 Y 18 74273573 TGTCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGC TATCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGC small deletion Het probably benign phenotype 12/04/2019
28 602741 UTSW Mms22l 1.000 RF005 G1 225.01 Y 4 24517207 I363V A G missense Het probably benign 0.265 phenotype 12/04/2019
29 602752 UTSW Myo7a 0.000 RF005 G1 225.01 Y 7 98093617 I391V T C missense Het probably benign 0.423 phenotype 12/04/2019
30 602767 UTSW Nab2 0.000 RF005 G1 225.01 Y 10 127664364 D286E A T missense Het probably benign 0.041 phenotype 12/04/2019
31 602793 UTSW Nrxn1 0.000 RF005 G1 225.01 Y 17 90362876 R1144C G A missense Het probably damaging 1.000 phenotype 12/04/2019
32 602736 UTSW Olfr1039 0.071 RF005 G1 225.01 N 2 86131070 M198V T C missense Het probably benign 0.014 phenotype 12/04/2019
33 602754 UTSW Olfr592 0.070 RF005 G1 225.01 Y 7 103186691 I30T T C missense Het possibly damaging 0.936 phenotype 12/04/2019
34 602756 UTSW Olfr635 0.083 RF005 G1 225.01 Y 7 103979561 D123G A G missense Het probably damaging 1.000 phenotype 12/04/2019
35 602768 UTSW Pan2 1.000 RF005 G1 225.01 Y 10 128315535 E842K G A missense Het probably benign 0.001 phenotype 12/04/2019
36 602727 UTSW Prex2 0.244 RF005 G1 225.01 Y 1 11185166 D1145A A C missense Het possibly damaging 0.467 phenotype 12/04/2019
37 602770 UTSW Prop1 0.680 RF005 G1 225.01 Y 11 50951130 Y150D A C missense Het possibly damaging 0.691 phenotype 12/04/2019
38 602748 UTSW Prp2 RF005 G1 217.47 N 6 132600501 AGGCCCACAGCAGCGACCCCCTCAAGGCCCACCACCACCAGGTGGCCCACAGCCGAGACCCCCTCAAGGCCCACCACC AGGCCCACAGCCGAGACCCCCTCAAGGCCCACCACC small deletion Het probably benign phenotype 12/04/2019
39 602744 UTSW Psip1 0.580 RF005 G1 225.01 Y 4 83460498 I353M T C missense Het probably damaging 0.999 phenotype 12/04/2019
40 628432 UTSW Rapgef1 1.000 RF005 G1 225.01 Y 2 29707195 C A splice site Het probably null 0.976 phenotype 04/07/2020
41 602732 UTSW Rgl1 0.379 RF005 G1 225.01 Y 1 152521363 S684L G A missense Het probably benign 0.000 phenotype 12/04/2019
42 602758 UTSW Sbf2 0.416 RF005 G1 225.01 Y 7 110317008 D1552V T A missense Het probably damaging 1.000 phenotype 12/04/2019
43 602753 UTSW Serpinh1 1.000 RF005 G1 225.01 Y 7 99346203 V391M C T missense Het probably damaging 0.999 phenotype 12/04/2019
44 602769 UTSW Slc35e4 0.082 RF005 G1 193.01 Y 11 3907960 L215Q A T missense Het possibly damaging 0.875 12/04/2019
45 602787 UTSW Tbl3 0.965 RF005 G1 214.46 N 17 24702541 TCTT TCTTCTT unclassified Het probably benign phenotype 12/04/2019
46 602759 UTSW Tex15 0.692 RF005 G1 225.01 Y 8 33576677 M2045K T A missense Het probably benign 0.048 phenotype 12/04/2019
47 602785 UTSW Tmprss15 0.000 RF005 G1 225.01 Y 16 78953801 *1070W T C makesense Het probably null phenotype 12/04/2019
48 602778 UTSW Trav15-2-dv6-2 0.061 RF005 G1 214.46 N 14 53649750 GGGAG GGGAGGAG small insertion Het probably benign 12/04/2019
49 602779 UTSW Trav15-2-dv6-2 0.061 RF005 G1 214.46 N 14 53649751 GGAG GGAGGAG small insertion Het probably benign 12/04/2019
50 602780 UTSW Trav15-2-dv6-2 0.061 RF005 G1 214.46 N 14 53649754 GAA GAACAA small insertion Het probably benign 12/04/2019
51 602740 UTSW Trim33 1.000 RF005 G1 130.51 N 3 103280212 GCCCCGGCCCCCG GCCCCG frame shift Het probably null phenotype 12/04/2019
52 602783 UTSW Triobp 1.000 RF005 G1 217.47 N 15 78967061 GACAA GACAACCCCAGGACTCCCTGTGCCCAACGGAACAA small insertion Het probably benign phenotype 12/04/2019
53 602757 UTSW Tub 0.000 RF005 G1 225.01 Y 7 109022639 Q95K C A missense Het probably benign 0.002 phenotype 12/04/2019
54 602788 UTSW Uhrf1bp1 0.000 RF005 G1 225.01 Y 17 27885531 D517V A T missense Het probably damaging 1.000 12/04/2019
55 602801 UTSW Usp9y 0.064 RF005 G1 222 Y Y 1435046 Q261L T A missense Het probably benign 0.428 phenotype 12/04/2019
56 602766 UTSW Utp20 0.958 RF005 G1 225.01 Y 10 88825457 D29E A T missense Het probably damaging 0.998 phenotype 12/04/2019
57 602763 UTSW Vill 0.070 RF005 G1 225.01 Y 9 119060439 V148M G A missense Het probably damaging 1.000 phenotype 12/04/2019
58 602792 UTSW Vmn2r120 0.099 RF005 G1 225.01 Y 17 57521991 E535K C T missense Het possibly damaging 0.653 12/04/2019
59 602728 UTSW Zfp451 0.000 RF005 G1 225.01 Y 1 33776792 Y692* A T nonsense Het probably null 12/04/2019
60 602761 UTSW Zfp599 0.075 RF005 G1 225.01 Y 9 22253884 V65G A C missense Het probably benign 0.030 12/04/2019
61 602774 UTSW Zfp808 0.088 RF005 G1 225.01 Y 13 62171299 V114A T C missense Het probably benign 0.143 12/04/2019
62 602790 UTSW Znrd1as 0.190 RF005 G1 171.47 Y 17 36965048 CACCACCACCACCACCACCAC CACCACCACCACCACCACCACAACCACCACCACCACCACCAC small insertion Het probably benign 12/04/2019
[records 1 to 62 of 62]