Incidental Mutations

58 incidental mutations are currently displayed, and affect 56 genes.
8 are Possibly Damaging.
8 are Probably Damaging.
30 are Probably Benign.
11 are Probably Null.
2 create premature stop codons.
5 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 58 of 58] per page Full List
ID question?
Source question?
Gene question?
E-score question?
Stock # question?
Gen question?
Vld question?
Strain question?
Chr question?
Position question?
Mutation question?
Type question?
Exon Dist question?
Zygosity question?
Predicted Effect question?
PPH Score question?
Meta Score question?
MGI Phenotype question?
Posted question?
1 602833 UTSW 1700057G04Rik 0.076 RF006 G1 225.01 Y 9 92352649 I146F A T missense Het possibly damaging 0.690 12/04/2019
2 602815 UTSW 4930548H24Rik 0.049 RF006 G1 225.01 Y 5 31487550 Q216* C T nonsense Het probably null 12/04/2019
3 602805 UTSW Acbd7 0.139 RF006 G1 110.47 N 2 3340699 GTT GT frame shift Het probably null 12/04/2019
4 602819 UTSW Acp7 0.314 RF006 G1 225.01 Y 7 28614779 N330K A T missense Het possibly damaging 0.942 phenotype 12/04/2019
5 602826 UTSW Adam25 0.073 RF006 G1 225.01 Y 8 40755797 H700L A T missense Het probably benign 0.000 phenotype 12/04/2019
6 602829 UTSW Alg9 1.000 RF006 G1 208.49 N 9 50775417 GGGTGG GGGTGGTGG unclassified Het probably benign phenotype 12/04/2019
7 602836 UTSW Atp8b3 0.083 RF006 G1 225.01 Y 10 80526236 V689E A T missense Het probably benign 0.152 phenotype 12/04/2019
8 602823 UTSW Atxn2l 0.920 RF006 G1 225.01 Y 7 126495891 V533A A G missense Het probably benign 0.001 phenotype 12/04/2019
9 602816 UTSW C87414 0.085 RF006 G1 225.01 N 5 93636703 C301S A T missense Het probably benign 0.163 12/04/2019
10 602841 UTSW Catsperb 0.076 RF006 G1 225.01 Y 12 101575979 G A critical splice donor site 1 bp Het probably null 12/04/2019
11 602834 UTSW Ccdc13 0.083 RF006 G1 225.01 Y 9 121814207 K376R T C missense Het probably damaging 0.999 0.112 12/04/2019
12 602835 UTSW Ccdc170 0.380 RF006 G1 212.47 N 10 4561030 C CCAA small insertion Het probably benign phenotype 12/04/2019
13 602845 UTSW Cdh9 0.134 RF006 G1 225.01 Y 15 16855830 R652P G C missense Het probably damaging 0.969 phenotype 12/04/2019
14 602804 UTSW Cenpf 0.633 RF006 G1 225.01 Y 1 189657386 C1416W A C missense Het probably damaging 0.997 phenotype 12/04/2019
15 602842 UTSW Chga 0.064 RF006 G1 209.47 N 12 102561412 GCA GCATCA small insertion Het probably benign phenotype 12/04/2019
16 602831 UTSW Cyb5r4 0.000 RF006 G1 217.47 N 9 87040425 TGTGACAGACACACTGCCCAGGGAAG TGTGACAGACACACTGCCCAGGGAAGTGACAGACACACTGCCCAGGGAAG small insertion Het probably benign phenotype 12/04/2019
17 602832 UTSW Cyb5r4 0.000 RF006 G1 217.47 N 9 87040441 CCCAGGGA CCCAGGGATGTGAGAGACACGCTGGCCAGGGA small insertion Het probably benign phenotype 12/04/2019
18 602848 UTSW Dennd3 0.200 RF006 G1 225.01 Y 15 73547592 I744T T C missense Het probably damaging 1.000 12/04/2019
19 602844 UTSW Dnah1 0.000 RF006 G1 225.01 Y 14 31307875 R491Q C T missense Het probably benign 0.078 phenotype 12/04/2019
20 602850 UTSW Eif4a2 0.578 RF006 G1 225.01 Y 16 23110278 M188L A T missense Het possibly damaging 0.928 12/04/2019
21 602806 UTSW Esf1 0.951 RF006 G1 105.47 N 2 140164374 CTCCTCTTC CTC small deletion Het probably benign 12/04/2019
22 602828 UTSW Fat3 0.597 RF006 G1 225.01 Y 9 15998617 I2030V T C missense Het probably benign 0.361 phenotype 12/04/2019
23 602855 UTSW Gab3 0.000 RF006 G1 110.47 N X 75000027 CTT CTTTTT small insertion Het probably benign phenotype 12/04/2019
24 602825 UTSW Gins4 1.000 RF006 G1 225.01 Y 8 23227167 V195E A T missense Het possibly damaging 0.712 phenotype 12/04/2019
25 602808 UTSW Gm17402 RF006 G1 165.47 N 3 67365559 TCCTCCTCC TCCTCCTCCCCCTCCTCC small insertion Het probably benign 12/04/2019
26 602856 UTSW Gm17604 RF006 G1 102.88 N X 165003818 CTCTCTTTC CTC frame shift Het probably null 12/04/2019
27 602854 UTSW Gm8369 0.058 RF006 G1 217.47 N 19 11511764 GTGTGT GTGTGTTTGTGT small insertion Het probably benign 12/04/2019
28 628447 UTSW Gnpnat1 1.000 RF006 G1 225.01 Y 14 45383443 T A splice site Het probably null phenotype 04/13/2020
29 602802 UTSW Inpp4a 0.230 RF006 G1 225.01 Y 1 37388827 N651T A C missense Het possibly damaging 0.762 phenotype 12/04/2019
30 602830 UTSW Ireb2 0.000 RF006 G1 225.01 Y 9 54881484 F81L T C missense Het possibly damaging 0.734 phenotype 12/04/2019
31 602849 UTSW Kcnh3 0.000 RF006 G1 225.01 Y 15 99239928 T A critical splice donor site 2 bp Het probably null phenotype 12/04/2019
32 602820 UTSW Kmt2b 1.000 RF006 G1 217.47 N 7 30586377 CTCCTC CTCCTCATCCTC unclassified Het probably benign phenotype 12/04/2019
33 602814 UTSW Kmt2c 1.000 RF006 G1 214.46 N 5 25315772 TG TGCTGTGG small insertion Het probably benign phenotype 12/04/2019
34 602807 UTSW Myt1 1.000 RF006 G1 225.01 Y 2 181797773 S405P T C missense Het probably damaging 0.997 phenotype 12/04/2019
35 602843 UTSW Net1 0.230 RF006 G1 225.01 Y 13 3887406 T245A T C missense Het probably benign 0.036 phenotype 12/04/2019
36 602840 UTSW Nkx2-1 1.000 RF006 G1 225.01 Y 12 56533547 T203A T C missense Het probably damaging 0.999 phenotype 12/04/2019
37 602817 UTSW Oas3 0.074 RF006 G1 225.01 Y 5 120774100 E75G T C missense Het probably damaging 1.000 phenotype 12/04/2019
38 602812 UTSW Pappa 0.751 RF006 G1 225.01 Y 4 65323873 D1491E T A missense Het probably benign 0.001 phenotype 12/04/2019
39 602846 UTSW Pkhd1l1 0.000 RF006 G1 225.01 Y 15 44503238 T704K C A missense Het probably benign 0.025 12/04/2019
40 602847 UTSW Pkhd1l1 0.000 RF006 G1 217.47 N 15 44558507 TT TTTTTTTTTGT critical splice acceptor site Het probably benign 12/04/2019
41 602813 UTSW Ppp1r8 1.000 RF006 G1 194.47 N 4 132830617 TCTCTCAC TC critical splice donor site Het probably benign phenotype 12/04/2019
42 602839 UTSW Ppp2r3c 0.967 RF006 G1 225.01 Y 12 55293815 I157F T A missense Het probably benign 0.239 phenotype 12/04/2019
43 628446 UTSW Rspo4 0.000 RF006 G1 225.01 Y 2 151867877 C T splice site Het probably null phenotype 04/13/2020
44 602837 UTSW Rtn4 0.840 RF006 G1 225.01 Y 11 29706919 S358P T C missense Het possibly damaging 0.826 phenotype 12/04/2019
45 602822 UTSW Siglecg 0.077 RF006 G1 225.01 Y 7 43408864 Y58* T A nonsense Het probably null phenotype 12/04/2019
46 602838 UTSW Slc4a1 1.000 RF006 G1 173.01 Y 11 102356716 C T critical splice donor site 1 bp Het probably null phenotype 12/04/2019
48 602811 UTSW Smc2 0.961 RF006 G1 225.01 Y 4 52442276 D64E T A missense Het probably benign 0.034 phenotype 12/04/2019
49 602810 UTSW Spaca1 0.000 RF006 G1 214.46 N 4 34049853 CTCGC CTCGCTATCGC small insertion Het probably benign phenotype 12/04/2019
50 602851 UTSW Srrm2 0.962 RF006 G1 225.01 Y 17 23812588 S236G A G missense Het unknown 0.062 12/04/2019
52 602853 UTSW Strn 0.654 RF006 G1 217.51 N 17 78677271 TGCTCCCTTACCCCAGTC TGCTCCCTTACCCCAGTCCGTGCTCCCTTACCCCAGTCCGAGCTCCCTTACCCCAGTC frame shift Het probably null phenotype 12/04/2019
53 602852 UTSW Tfeb 1.000 RF006 G1 159.47 N 17 47786113 CAG CAGGAG small insertion Het probably benign phenotype 12/04/2019
54 602827 UTSW Tktl2 0.401 RF006 G1 225.01 Y 8 66512852 E354V A T missense Het probably benign 0.315 12/04/2019
55 602824 UTSW Tpte 0.076 RF006 G1 225.01 Y 8 22306943 T94A A G missense Het probably benign 0.000 phenotype 12/04/2019
56 602803 UTSW Usp40 0.000 RF006 G1 225.01 Y 1 87967195 S868A A C missense Het possibly damaging 0.466 phenotype 12/04/2019
57 602818 UTSW Vmn2r24 0.055 RF006 G1 225.01 Y 6 123806419 C526Y G A missense Het probably damaging 0.999 12/04/2019
58 602821 UTSW Vmn2r58 0.359 RF006 G1 214.46 N 7 41836959 CAAAATGATGTAGCACTT C frame shift Het probably null 12/04/2019
[records 1 to 58 of 58]