Incidental Mutations

58 incidental mutations are currently displayed, and affect 56 genes.
8 are Possibly Damaging.
8 are Probably Damaging.
30 are Probably Benign.
11 are Probably Null.
2 create premature stop codons.
5 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 58 of 58] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 602833 UTSW 1700057G04Rik 0.064 RF006 G1 225.01 Y 9 92352649 I146F A T missense Het possibly damaging 0.690 12/04/2019
2 602815 UTSW 4930548H24Rik 0.053 RF006 G1 225.01 Y 5 31487550 Q216* C T nonsense Het probably null 12/04/2019
3 602805 UTSW Acbd7 0.114 RF006 G1 110.47 N 2 3340699 GTT GT frame shift Het probably null 12/04/2019
4 602819 UTSW Acp7 0.263 RF006 G1 225.01 Y 7 28614779 N330K A T missense Het possibly damaging 0.942 phenotype 12/04/2019
5 602826 UTSW Adam25 0.070 RF006 G1 225.01 Y 8 40755797 H700L A T missense Het probably benign 0.000 phenotype 12/04/2019
6 602829 UTSW Alg9 1.000 RF006 G1 208.49 N 9 50775417 GGGTGG GGGTGGTGG unclassified Het probably benign phenotype 12/04/2019
7 602836 UTSW Atp8b3 0.111 RF006 G1 225.01 Y 10 80526236 V689E A T missense Het probably benign 0.152 phenotype 12/04/2019
8 602823 UTSW Atxn2l 0.905 RF006 G1 225.01 Y 7 126495891 V533A A G missense Het probably benign 0.001 phenotype 12/04/2019
9 602816 UTSW C87414 0.076 RF006 G1 225.01 N 5 93636703 C301S A T missense Het probably benign 0.163 12/04/2019
10 602841 UTSW Catsperb 0.068 RF006 G1 225.01 Y 12 101575979 G A critical splice donor site 1 bp Het probably null 12/04/2019
11 602834 UTSW Ccdc13 0.084 RF006 G1 225.01 Y 9 121814207 K376R T C missense Het probably damaging 0.999 0.112 12/04/2019
12 602835 UTSW Ccdc170 0.337 RF006 G1 212.47 N 10 4561030 C CCAA small insertion Het probably benign phenotype 12/04/2019
13 602845 UTSW Cdh9 0.131 RF006 G1 225.01 Y 15 16855830 R652P G C missense Het probably damaging 0.969 phenotype 12/04/2019
14 602804 UTSW Cenpf 0.542 RF006 G1 225.01 Y 1 189657386 C1416W A C missense Het probably damaging 0.997 phenotype 12/04/2019
15 602842 UTSW Chga 0.084 RF006 G1 209.47 N 12 102561412 GCA GCATCA small insertion Het probably benign phenotype 12/04/2019
16 602831 UTSW Cyb5r4 0.000 RF006 G1 217.47 N 9 87040425 TGTGACAGACACACTGCCCAGGGAAG TGTGACAGACACACTGCCCAGGGAAGTGACAGACACACTGCCCAGGGAAG small insertion Het probably benign phenotype 12/04/2019
17 602832 UTSW Cyb5r4 0.000 RF006 G1 217.47 N 9 87040441 CCCAGGGA CCCAGGGATGTGAGAGACACGCTGGCCAGGGA small insertion Het probably benign phenotype 12/04/2019
18 602848 UTSW Dennd3 0.163 RF006 G1 225.01 Y 15 73547592 I744T T C missense Het probably damaging 1.000 12/04/2019
19 602844 UTSW Dnah1 0.000 RF006 G1 225.01 Y 14 31307875 R491Q C T missense Het probably benign 0.078 phenotype 12/04/2019
20 602850 UTSW Eif4a2 0.699 RF006 G1 225.01 Y 16 23110278 M188L A T missense Het possibly damaging 0.928 12/04/2019
21 602806 UTSW Esf1 0.942 RF006 G1 105.47 N 2 140164374 CTCCTCTTC CTC small deletion Het probably benign 12/04/2019
22 602828 UTSW Fat3 0.571 RF006 G1 225.01 Y 9 15998617 I2030V T C missense Het probably benign 0.361 phenotype 12/04/2019
23 602855 UTSW Gab3 0.000 RF006 G1 110.47 N X 75000027 CTT CTTTTT small insertion Het probably benign phenotype 12/04/2019
24 602825 UTSW Gins4 1.000 RF006 G1 225.01 Y 8 23227167 V195E A T missense Het possibly damaging 0.712 phenotype 12/04/2019
25 602808 UTSW Gm17402 RF006 G1 165.47 N 3 67365559 TCCTCCTCC TCCTCCTCCCCCTCCTCC small insertion Het probably benign 12/04/2019
26 602856 UTSW Gm17604 RF006 G1 102.88 N X 165003818 CTCTCTTTC CTC frame shift Het probably null 12/04/2019
27 602854 UTSW Gm8369 0.066 RF006 G1 217.47 N 19 11511764 GTGTGT GTGTGTTTGTGT small insertion Het probably benign 12/04/2019
28 628447 UTSW Gnpnat1 1.000 RF006 G1 225.01 Y 14 45383443 T A utr 5 prime Het probably null phenotype 04/13/2020
29 602802 UTSW Inpp4a 0.192 RF006 G1 225.01 Y 1 37388827 N651T A C missense Het possibly damaging 0.762 phenotype 12/04/2019
30 602830 UTSW Ireb2 0.000 RF006 G1 225.01 Y 9 54881484 F81L T C missense Het possibly damaging 0.734 phenotype 12/04/2019
31 602849 UTSW Kcnh3 0.000 RF006 G1 225.01 Y 15 99239928 T A critical splice donor site 2 bp Het probably null phenotype 12/04/2019
32 602820 UTSW Kmt2b 1.000 RF006 G1 217.47 N 7 30586377 CTCCTC CTCCTCATCCTC unclassified Het probably benign phenotype 12/04/2019
33 602814 UTSW Kmt2c 1.000 RF006 G1 214.46 N 5 25315772 TG TGCTGTGG small insertion Het probably benign phenotype 12/04/2019
34 602807 UTSW Myt1 1.000 RF006 G1 225.01 Y 2 181797773 S405P T C missense Het probably damaging 0.997 phenotype 12/04/2019
35 602843 UTSW Net1 0.259 RF006 G1 225.01 Y 13 3887406 T245A T C missense Het probably benign 0.036 phenotype 12/04/2019
36 602840 UTSW Nkx2-1 1.000 RF006 G1 225.01 Y 12 56533547 T203A T C missense Het probably damaging 0.999 phenotype 12/04/2019
37 602817 UTSW Oas3 0.108 RF006 G1 225.01 Y 5 120774100 E75G T C missense Het probably damaging 1.000 phenotype 12/04/2019
38 602812 UTSW Pappa 0.679 RF006 G1 225.01 Y 4 65323873 D1491E T A missense Het probably benign 0.001 phenotype 12/04/2019
39 602846 UTSW Pkhd1l1 0.000 RF006 G1 225.01 Y 15 44503238 T704K C A missense Het probably benign 0.025 12/04/2019
40 602847 UTSW Pkhd1l1 0.000 RF006 G1 217.47 N 15 44558507 TT TTTTTTTTTGT critical splice acceptor site Het probably benign 12/04/2019
41 602813 UTSW Ppp1r8 1.000 RF006 G1 194.47 N 4 132830617 TCTCTCAC TC critical splice donor site Het probably benign phenotype 12/04/2019
42 602839 UTSW Ppp2r3c 0.963 RF006 G1 225.01 Y 12 55293815 I157F T A missense Het probably benign 0.239 phenotype 12/04/2019
43 628446 UTSW Rspo4 0.000 RF006 G1 225.01 Y 2 151867877 C T synonymous Het probably null phenotype 04/13/2020
44 602837 UTSW Rtn4 0.756 RF006 G1 225.01 Y 11 29706919 S358P T C missense Het possibly damaging 0.826 phenotype 12/04/2019
45 602822 UTSW Siglecg 0.104 RF006 G1 225.01 Y 7 43408864 Y58* T A nonsense Het probably null phenotype 12/04/2019
46 602838 UTSW Slc4a1 1.000 RF006 G1 173.01 Y 11 102356716 C T critical splice donor site 1 bp Het probably null phenotype 12/04/2019
47 602809 UTSW Slc9b1 0.090 RF006 G1 146.46 N 3 135357542 CGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGG CGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGGAACCAGAAAGGAAGG small deletion Het probably benign phenotype 12/04/2019
48 602811 UTSW Smc2 0.961 RF006 G1 225.01 Y 4 52442276 D64E T A missense Het probably benign 0.034 phenotype 12/04/2019
49 602810 UTSW Spaca1 0.000 RF006 G1 214.46 N 4 34049853 CTCGC CTCGCTATCGC small insertion Het probably benign phenotype 12/04/2019
50 602851 UTSW Srrm2 0.957 RF006 G1 225.01 Y 17 23812588 S236G A G missense Het unknown 0.062 12/04/2019
51 602857 UTSW Sry 0.318 RF006 G1 205.46 N Y 2662638 GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG small deletion Het probably benign phenotype 12/04/2019
52 602853 UTSW Strn 0.499 RF006 G1 217.51 N 17 78677271 TGCTCCCTTACCCCAGTC TGCTCCCTTACCCCAGTCCGTGCTCCCTTACCCCAGTCCGAGCTCCCTTACCCCAGTC frame shift Het probably null phenotype 12/04/2019
53 602852 UTSW Tfeb 1.000 RF006 G1 159.47 N 17 47786113 CAG CAGGAG small insertion Het probably benign phenotype 12/04/2019
54 602827 UTSW Tktl2 0.519 RF006 G1 225.01 Y 8 66512852 E354V A T missense Het probably benign 0.315 12/04/2019
55 602824 UTSW Tpte 0.081 RF006 G1 225.01 Y 8 22306943 T94A A G missense Het probably benign 0.000 phenotype 12/04/2019
56 602803 UTSW Usp40 0.000 RF006 G1 225.01 Y 1 87967195 S868A A C missense Het possibly damaging 0.466 phenotype 12/04/2019
57 602818 UTSW Vmn2r24 0.057 RF006 G1 225.01 Y 6 123806419 C526Y G A missense Het probably damaging 0.999 12/04/2019
58 602821 UTSW Vmn2r58 0.329 RF006 G1 214.46 N 7 41836959 CAAAATGATGTAGCACTT C frame shift Het probably null 12/04/2019
[records 1 to 58 of 58]