Incidental Mutations

71 incidental mutations are currently displayed, and affect 68 genes.
5 are Possibly Damaging.
14 are Probably Damaging.
41 are Probably Benign.
10 are Probably Null.
1 create premature stop codons.
3 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 71 of 71] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 603162 UTSW 2300002M23Rik 0.093 RF010 G1 187.46 N 17 35568576 GGGTTATGGTCAGTACCCCCCAGTAGGGACCTGGGGCGGTTATGGTCAGTACCCCCCAGTAGGGCCCTGGGGCGGTTATGGTCAGTACCCCCCAGTAGGGACCTGGGG GGGTTATGGTCAGTACCCCCCAGTAGGGCCCTGGGGCGGTTATGGTCAGTACCCCCCAGTAGGGACCTGGGG small deletion Het probably benign phenotype 12/04/2019
2 603122 UTSW Acap3 0.144 RF010 G1 214.72 N 4 155905096 CCTGGGCTGCTG CCTGGGCTGCTGCATACTGGGCTGCTG small insertion Het probably benign 12/04/2019
3 603152 UTSW Ankrd28 0.405 RF010 G1 225.01 N 14 31778986 I16T A G missense Het probably damaging 0.999 12/04/2019
4 603133 UTSW AY761185 0.068 RF010 G1 217.47 N 8 20943911 GCACTGTGGGC G frame shift Het probably null 12/04/2019
5 603150 UTSW B020031M17Rik 0.076 RF010 G1 225.01 N 13 119950046 V8E A T missense Het probably benign 0.002 12/04/2019
6 603139 UTSW Bend3 1.000 RF010 G1 225.01 N 10 43510184 F191Y T A missense Het possibly damaging 0.823 12/04/2019
7 603174 UTSW Calhm1 0.000 RF010 G1 217.68 N 19 47141273 GTGGC GTGGCTGTGGCTATGGC unclassified Het probably benign phenotype 12/04/2019
8 603136 UTSW Camkv 0.000 RF010 G1 217.47 N 9 107947860 CGCTGCTGC CGC unclassified Het probably benign 12/04/2019
9 603147 UTSW Chga 0.073 RF010 G1 162.47 N 12 102561403 GCA GCATCA small insertion Het probably benign phenotype 12/04/2019
10 603135 UTSW Cngb1 1.000 RF010 G1 136.47 N 8 95303650 CTCTGGCTCTGGCTCTGGCTCTG C frame shift Het probably null phenotype 12/04/2019
11 603129 UTSW Cnot3 1.000 RF010 G1 225.01 N 7 3656069 V438A T C missense Het probably benign 0.008 phenotype 12/04/2019
12 603168 UTSW Cntnap5c 0.072 RF010 G1 156.01 N 17 58286795 W710R T A missense Het probably damaging 1.000 12/04/2019
13 603155 UTSW Dyrk1a 1.000 RF010 G1 225.01 N 16 94677563 S404G A G missense Het probably benign 0.000 phenotype 12/04/2019
14 603121 UTSW Efhd2 0.116 RF010 G1 217.47 N 4 141874764 GCCGCC GCCGCCTCCGCC small insertion Het probably benign phenotype 12/04/2019
15 603160 UTSW Flywch1 1.000 RF010 G1 217.47 N 17 23762175 GTGT GTGTGGGGAGGCTACGTACTCACCCACACCTGTTGT frame shift Het probably null 12/04/2019
16 603110 UTSW Fmn2 0.792 RF010 G1 112.01 N 1 174582015 S605T T A missense Het unknown phenotype 12/04/2019
17 603176 UTSW Gab3 0.000 RF010 G1 139.47 N X 75000011 TCT TCTGCT small insertion Het probably benign phenotype 12/04/2019
18 603175 UTSW Gabre RF010 G1 119.47 N X 72270060 GCTC GCTCCGTCTC small insertion Het probably benign 12/04/2019
19 603149 UTSW Gli3 1.000 RF010 G1 225.01 N 13 15726369 Y1447C A G missense Het probably damaging 1.000 phenotype 12/04/2019
20 603108 UTSW Hibch 0.366 RF010 G1 225.01 N 1 52913732 V297A T C missense Het probably benign 0.008 phenotype 12/04/2019
21 603109 UTSW Ifi213 0.064 RF010 G1 186.01 N 1 173582153 D462H C G missense Het probably damaging 0.979 12/04/2019
22 603167 UTSW Kcnh8 0.000 RF010 G1 225.01 N 17 52978239 R1079H G A missense Het probably benign 0.004 phenotype 12/04/2019
23 603119 UTSW Lce1m RF010 G1 213.47 N 3 93018290 GCTGCTGCC GCTGCTGCCCCCACTGCTGCC unclassified Het probably benign 12/04/2019
24 603145 UTSW Lpo 0.000 RF010 G1 225.01 N 11 87821102 V43A A G missense Het probably benign 0.001 phenotype 12/04/2019
25 603116 UTSW Map1a 0.424 RF010 G1 217.47 N 2 121306318 A AGCTCCAGCTCCAGCCCCACCTCCAGCTCCC small insertion Het probably benign phenotype 12/04/2019
26 603142 UTSW Mapk9 0.328 RF010 G1 225.01 N 11 49854256 A G start gained Het probably benign phenotype 12/04/2019
27 603164 UTSW Mep1a 0.000 RF010 G1 225.01 N 17 43486235 H314Y G A missense Het probably damaging 0.994 phenotype 12/04/2019
28 603143 UTSW Myh3 0.318 RF010 G1 217.47 N 11 67086356 ATTAC ATTACTTAC frame shift Het probably null phenotype 12/04/2019
29 603144 UTSW Myh3 0.318 RF010 G1 217.47 N 11 67086359 AC ACTTCC frame shift Het probably null phenotype 12/04/2019
30 603114 UTSW Nusap1 1.000 RF010 G1 130.47 N 2 119627584 ACGTTAGCAGTGAGGAGCAA ACGTTAGCAGTGAGGAGCAAACTGAGATACTCGTTAGCAGTGAGGAGCAA small insertion Het probably benign phenotype 12/04/2019
31 603112 UTSW Olfr1118 0.067 RF010 G1 225.01 N 2 87308840 V37E T A missense Het possibly damaging 0.829 phenotype 12/04/2019
32 603131 UTSW Olfr305 0.105 RF010 G1 225.01 N 7 86363386 Q317R T C missense Het probably benign 0.025 phenotype 12/04/2019
33 603173 UTSW Pdcd11 0.966 RF010 G1 217.47 N 19 47113451 AGGAGG A frame shift Het probably null phenotype 12/04/2019
34 603153 UTSW Pfkm 0.790 RF010 G1 225.01 N 15 98129793 I651N T A missense Het possibly damaging 0.784 phenotype 12/04/2019
35 603130 UTSW Phldb3 0.098 RF010 G1 217.47 N 7 24626495 CCCCCGCCCC CCCCC frame shift Het probably null 12/04/2019
36 603170 UTSW Prkce 0.000 RF010 G1 225.01 N 17 86488199 V288A T C missense Het probably damaging 0.974 phenotype 12/04/2019
37 603117 UTSW Pxmp4 0.066 RF010 G1 225.01 N 2 154592263 S93P A G missense Het probably damaging 0.998 12/04/2019
38 603154 UTSW Rfc4 0.965 RF010 G1 225.01 N 16 23127482 T17A T C missense Het probably benign 0.000 phenotype 12/04/2019
39 603140 UTSW Rfx4 1.000 RF010 G1 217.47 N 10 84858487 CTCTCTCT CTCTCTCTCTCTCTCTATCTCTCT critical splice acceptor site Het probably benign phenotype 12/04/2019
40 603113 UTSW Ryr3 0.491 RF010 G1 225.01 N 2 112775670 A2415E G T missense Het probably damaging 0.966 phenotype 12/04/2019
41 603161 UTSW Sbp 0.062 RF010 G1 217.47 N 17 23945351 ACAAAGATGCTGACAACAAAGATGCTGACA ACAAAGATGCTGACACCAAAGATGCTGACAACAAAGATGCTGACA small insertion Het probably benign 12/04/2019
42 603151 UTSW Sec24c 1.000 RF010 G1 225.01 N 14 20688715 T A splice site Het probably null phenotype 12/04/2019
43 603138 UTSW Sec63 1.000 RF010 G1 225.01 N 10 42806624 A437E C A missense Het probably benign 0.035 phenotype 12/04/2019
44 603169 UTSW Six3 1.000 RF010 G1 187.47 N 17 85621355 GCG GCGTCG small insertion Het probably benign phenotype 12/04/2019
45 603107 UTSW Slco5a1 0.150 RF010 G1 225.01 N 1 12871947 T825I G A missense Het probably damaging 0.996 phenotype 12/04/2019
46 603177 UTSW Stard8 0.000 RF010 G1 205.47 N X 99066517 GGA GGAAGA unclassified Het probably benign phenotype 12/04/2019
47 603111 UTSW Stxbp1 0.801 RF010 G1 225.01 N 2 32821915 V30A A G missense Het probably benign 0.058 phenotype 12/04/2019
48 603118 UTSW Supt20 0.950 RF010 G1 217.47 N 3 54727662 AGCAGC AGCAGCGGCAGC small insertion Het probably benign phenotype 12/04/2019
49 603137 UTSW Syne1 1.000 RF010 G1 225.01 N 10 5246386 D3882V T A missense Het possibly damaging 0.892 phenotype 12/04/2019
50 603158 UTSW T 0.955 RF010 G1 225.01 N 17 8441708 T384A A G missense Het probably benign 0.000 phenotype 12/04/2019
51 603172 UTSW Tbc1d12 0.536 RF010 G1 214.67 N 19 38836940 CGGGGCGG CG small deletion Het probably benign 12/04/2019
52 603171 UTSW Tcof1 1.000 RF010 G1 181.47 N 18 60835744 CAG CAGAAG unclassified Het probably benign phenotype 12/04/2019
53 603165 UTSW Tfeb 1.000 RF010 G1 166.47 N 17 47786094 GCA GCAACA small insertion Het probably benign phenotype 12/04/2019
54 603166 UTSW Tfeb 1.000 RF010 G1 167.47 N 17 47786107 CAG CAGAAG small insertion Het probably benign phenotype 12/04/2019
55 603123 UTSW Thegl 0.060 RF010 G1 217.47 N 5 77016427 CAG CAGCGATCCTCCCCAGTCCCGCAAGGCGAG small insertion Het probably benign 12/04/2019
56 603125 UTSW Thumpd3 0.287 RF010 G1 225.01 N 6 113056045 A248V C T missense Het probably damaging 0.996 12/04/2019
57 603156 UTSW Tmem181a 0.000 RF010 G1 225.01 N 17 6280703 T C critical splice donor site 2 bp Het probably null phenotype 12/04/2019
58 603120 UTSW Tmem56 0.065 RF010 G1 225.01 N 3 121228884 I103L T A missense Het probably benign 0.001 12/04/2019
59 603141 UTSW Trim41 0.357 RF010 G1 225.01 N 11 48807338 H600Q A T missense Het probably damaging 0.999 phenotype 12/04/2019
60 603115 UTSW Ttbk2 1.000 RF010 G1 225.01 N 2 120790339 C147* A T nonsense Het probably null phenotype 12/04/2019
61 603157 UTSW Ttll2 0.180 RF010 G1 225.01 N 17 7351338 A397T C T missense Het probably benign 0.047 12/04/2019
62 603148 UTSW Unc79 1.000 RF010 G1 225.01 N 12 103112787 L1737Q T A missense Het probably benign 0.170 phenotype 12/04/2019
63 603132 UTSW Usp47 0.896 RF010 G1 225.01 N 7 112092938 V869E T A missense Het probably damaging 0.987 phenotype 12/04/2019
64 603159 UTSW Vmn1r231 0.049 RF010 G1 225.01 N 17 20889993 Q220L T A missense Het probably damaging 0.989 12/04/2019
65 603126 UTSW Vmn2r26 0.079 RF010 G1 225.01 N 6 124039489 T304I C T missense Het possibly damaging 0.899 phenotype 12/04/2019
66 603124 UTSW Wdr66 0.081 RF010 G1 139.47 N 5 123274161 TCTCA T critical splice acceptor site Het probably benign phenotype 12/04/2019
67 603134 UTSW Wrn 0.351 RF010 G1 225.01 N 8 33288765 N839S T C missense Het probably benign 0.129 phenotype 12/04/2019
68 603127 UTSW Zfp384 0.254 RF010 G1 217.47 N 6 125036471 GCCCAGGCCCAGGCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAGGCCCAGGCCCAG unclassified Het probably benign phenotype 12/04/2019
69 603128 UTSW Zfp384 0.254 RF010 G1 115.47 N 6 125036488 GGCCCAGG GGCCCAGGAGCACGCCCAGG unclassified Het probably benign phenotype 12/04/2019
70 603146 UTSW Zfyve26 0.000 RF010 G1 225.01 N 12 79255338 C1828Y C T missense Het probably damaging 1.000 phenotype 12/04/2019
71 603163 UTSW Znrd1as 0.135 RF010 G1 217.47 N 17 36965063 CACCACCAC CACCACCACCACCACCACCACTACCACCAC small insertion Het probably benign 12/04/2019
[records 1 to 71 of 71]