Incidental Mutations

64 incidental mutations are currently displayed, and affect 59 genes.
4 are Possibly Damaging.
11 are Probably Damaging.
43 are Probably Benign.
4 are Probably Null.
0 create premature stop codons.
6 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 64 of 64] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 603238 UTSW 9930021J03Rik 0.097 RF011 G1 225.01 N 19 29743609 K672R T C missense Het possibly damaging 0.528 12/04/2019
2 603178 UTSW A030005L19Rik RF011 G1 214.97 N 1 82913569 GTGGTGGCTG GTGGTGGCTGTGGTGGCTG small insertion Het probably benign 12/04/2019
3 603179 UTSW A030005L19Rik RF011 G1 217.68 N 1 82913573 TGGCTGCTG TGGCTGCTGGGGCTGCTG small insertion Het probably benign 12/04/2019
4 603180 UTSW A030005L19Rik RF011 G1 217.48 N 1 82913586 TGCTG TGCTGTGGCGGCTG small insertion Het probably benign 12/04/2019
5 603236 UTSW AI837181 0.000 RF011 G1 127.47 N 19 5425236 GCG GCGTCG small insertion Het probably benign 12/04/2019
6 603217 UTSW Ankrd24 0.568 RF011 G1 214.46 N 10 81643571 C CGGAGGCAGAGGA unclassified Het probably benign 12/04/2019
7 603227 UTSW Aqp2 0.280 RF011 G1 225.01 N 15 99583872 S216P T C missense Het probably damaging 0.999 phenotype 12/04/2019
8 603240 UTSW Cacna1f 0.000 RF011 G1 139.47 N X 7620056 GGA GGAAGA utr 3 prime Het probably benign phenotype 12/04/2019
9 603215 UTSW Ccdc170 0.355 RF011 G1 192.47 N 10 4561018 CCA CCAGCA small insertion Het probably benign phenotype 12/04/2019
10 603213 UTSW Cd109 0.000 RF011 G1 217.47 N 9 78712528 TATTTAT TATTTATTTATTCATTTAT critical splice acceptor site Het probably benign phenotype 12/04/2019
11 603195 UTSW Cela2a 0.092 RF011 G1 225.01 N 4 141821715 N117D T C missense Het probably benign 0.000 phenotype 12/04/2019
12 603231 UTSW Cul9 0.334 RF011 G1 201.47 N 17 46500848 CTTC CTTCTTC small insertion Het probably benign phenotype 12/04/2019
13 603206 UTSW Cyb5r2 0.000 RF011 G1 225.01 N 7 107751168 S235R A T missense Het probably benign 0.001 phenotype 12/04/2019
14 603209 UTSW Dnmt1 1.000 RF011 G1 217.47 N 9 20910128 CACAGTTCCTACCTCGTT CACAGTTCCTACCTCGTTTTGGGGGCGGAGAACAGTTCCTACCTCGTT nonsense Het probably null phenotype 12/04/2019
15 603210 UTSW Dnmt1 1.000 RF011 G1 217.47 N 9 20910144 TT TTTTGGGGGCGGAGCACAGTTCCTACCTCGAT nonsense Het probably null phenotype 12/04/2019
16 603230 UTSW E4f1 1.000 RF011 G1 217.47 N 17 24455186 CCG CCGTCG unclassified Het probably benign phenotype 12/04/2019
17 603182 UTSW Fam171b 0.091 RF011 G1 214.46 N 2 83812873 TCCAGCA TCCAGCACCAGCA small insertion Het probably benign 12/04/2019
18 603183 UTSW Fam171b 0.091 RF011 G1 217.47 N 2 83812895 GC GCAGCATC small insertion Het probably benign 12/04/2019
19 603225 UTSW Fam81b 0.134 RF011 G1 214.46 N 13 76271316 CTGTT CTGTTGTT small insertion Het probably benign 12/04/2019
20 603185 UTSW Fkbp1a 1.000 RF011 G1 214.46 N 2 151542699 GCCGCCGCCA G start codon destroyed Het probably null phenotype 12/04/2019
21 603221 UTSW Flii 1.000 RF011 G1 225.01 N 11 60716243 A969V G A missense Het probably benign 0.041 phenotype 12/04/2019
22 603222 UTSW Fscb 0.095 RF011 G1 214.46 N 12 64472994 AGTGGAACTTCTGCAGGCCCCTCTTCAGTTAGTGTAGGTGGAACTTCTGCAGGCCCCTCTTCAGTTAGTGGAGGTGGAACTTCTGCAGG AGTGGAACTTCTGCAGGCCCCTCTTCAGTTAGTGGAGGTGGAACTTCTGCAGG small deletion Het probably benign 12/04/2019
23 603224 UTSW Gas1 0.581 RF011 G1 119.59 N 13 60176531 G GAAA small insertion Het probably benign phenotype 12/04/2019
24 603218 UTSW Grip1 1.000 RF011 G1 225.01 N 10 119931315 D115G A G missense Het probably null 0.968 phenotype 12/04/2019
25 603193 UTSW Guca2b 0.086 RF011 G1 225.01 N 4 119656847 T89N G T missense Het possibly damaging 0.932 phenotype 12/04/2019
26 603211 UTSW Hcn4 1.000 RF011 G1 225.01 N 9 58859915 S920T T A missense Het unknown phenotype 12/04/2019
27 603223 UTSW Heatr1 0.965 RF011 G1 225.01 N 13 12407544 M484V A G missense Het probably benign 0.002 12/04/2019
28 603220 UTSW Iba57 0.578 RF011 G1 225.01 N 11 59163612 A27E G T missense Het probably benign 0.051 phenotype 12/04/2019
29 603181 UTSW Ifi207 0.112 RF011 G1 84.01 N 1 173729121 L684V G C missense Het not run 12/04/2019
30 603205 UTSW Ints13 0.959 RF011 G1 225.01 N 6 146556240 H380R T C missense Het probably damaging 0.988 12/04/2019
31 603216 UTSW Jmjd1c 0.719 RF011 G1 225.01 N 10 67220199 T466I C T missense Het possibly damaging 0.468 phenotype 12/04/2019
32 603232 UTSW Kcnh8 0.000 RF011 G1 225.01 N 17 52978239 R1079H G A missense Het probably benign 0.004 phenotype 12/04/2019
33 603192 UTSW Kif12 0.250 RF011 G1 214.46 N 4 63171427 C CCTCCACCCGGCGGGG small insertion Het probably benign phenotype 12/04/2019
34 603197 UTSW Kmt2c 1.000 RF011 G1 225.01 N 5 25338459 D1399E A T missense Het probably damaging 0.998 phenotype 12/04/2019
35 603194 UTSW Macf1 1.000 RF011 G1 225.01 N 4 123473855 L2371Q A T missense Het probably damaging 1.000 phenotype 12/04/2019
36 603235 UTSW Mbd1 0.000 RF011 G1 217.64 N 18 74273610 GTCTTCGTCTGCATCTGCATCTGCATCT GTCT small deletion Het probably benign phenotype 12/04/2019
37 603189 UTSW Med12l 0.408 RF011 G1 211.47 N 3 59275980 GCA GCATCA small insertion Het probably benign phenotype 12/04/2019
38 603202 UTSW Mgam 0.123 RF011 G1 225.01 N 6 40757436 Q1472K C A missense Het probably damaging 1.000 phenotype 12/04/2019
39 603191 UTSW Mup21 0.070 RF011 G1 214.46 N 4 62149345 TATACTT TATACTTTTTAGATACTT critical splice donor site Het probably benign 12/04/2019
40 603199 UTSW Nipal1 0.096 RF011 G1 184.01 N 5 72666813 N167D A G missense Het probably damaging 1.000 12/04/2019
41 603184 UTSW Olfr1105 0.067 RF011 G1 225.01 N 2 87034041 Y60F T A missense Het probably damaging 0.965 phenotype 12/04/2019
42 603237 UTSW Olfr1426 0.083 RF011 G1 225.01 N 19 12088247 V182I C T missense Het probably benign 0.086 phenotype 12/04/2019
43 603203 UTSW Osbpl3 0.000 RF011 G1 109.47 N 6 50348138 CCTGCA C critical splice acceptor site Het probably benign phenotype 12/04/2019
44 603186 UTSW Phf20 0.898 RF011 G1 214.46 N 2 156304620 CCCCCCCCC CCCCCCCCCCCCCCCC critical splice acceptor site Het probably benign phenotype 12/04/2019
45 603187 UTSW Phf20 0.898 RF011 G1 214.46 N 2 156304621 CCCCCCCC CCCCCCCCCCCCCCC critical splice acceptor site Het probably benign phenotype 12/04/2019
46 603196 UTSW Pramef25 0.063 RF011 G1 225.01 N 4 143948908 Q449H C G missense Het probably damaging 0.963 12/04/2019
47 603200 UTSW Rassf6 0.104 RF011 G1 152.47 N 5 90608921 TCCTGTAGAGCAATGGGGATTC TCCTGTAGAGCAATGGGGATTCTGCCTCACTCATGGGCCTGTAGAGCAATGGGGATTC utr 3 prime Het probably benign phenotype 12/04/2019
48 603198 UTSW Rbm33 1.000 RF011 G1 162.49 N 5 28394181 CCAGCCGCAGC CCAGC small deletion Het probably benign 12/04/2019
49 603226 UTSW Rubcnl 0.160 RF011 G1 225.01 N 14 75044438 F445S T C missense Het probably damaging 0.988 12/04/2019
50 603190 UTSW S100a10 0.168 RF011 G1 214.46 N 3 93564234 TTTTTTTA T critical splice acceptor site Het probably benign phenotype 12/04/2019
51 603229 UTSW Sbp 0.071 RF011 G1 217.47 N 17 23945354 AA AAAATGCTGACAACGGA small insertion Het probably benign 12/04/2019
52 603219 UTSW Sec14l3 0.119 RF011 G1 225.01 N 11 4067963 Q81P A C missense Het possibly damaging 0.951 phenotype 12/04/2019
53 603207 UTSW Setd1a 1.000 RF011 G1 217.47 N 7 127785343 TGGTGGTGG TGGTGGTGGGGGTGGTGG unclassified Het probably benign phenotype 12/04/2019
54 603233 UTSW Six3 1.000 RF011 G1 146.47 N 17 85621368 CGG CGGGGG small insertion Het probably benign phenotype 12/04/2019
55 603212 UTSW Snapc5 0.946 RF011 G1 217.47 N 9 64182211 ATGGAAGAAGAGG A unclassified Het probably benign phenotype 12/04/2019
56 603239 UTSW Tbc1d12 0.535 RF011 G1 217.5 N 19 38836957 CGGAGGAGG CGG small deletion Het probably benign 12/04/2019
57 603234 UTSW Tcof1 1.000 RF011 G1 181.47 N 18 60835739 AGC AGCCGC unclassified Het probably benign phenotype 12/04/2019
58 603241 UTSW Tmem28 0.097 RF011 G1 214.47 N X 99821361 CGCCGC CGCCGCAGCCGC small insertion Het probably benign phenotype 12/04/2019
59 603188 UTSW Tox2 0.000 RF011 G1 225.01 N 2 163225564 I68V A G missense Het probably benign 0.020 12/04/2019
60 603208 UTSW Triml2 0.061 RF011 G1 193.01 N 8 43183164 G T start gained Het probably benign phenotype 12/04/2019
61 603201 UTSW Tspan33 0.092 RF011 G1 225.01 N 6 29716730 Y162C A G missense Het probably damaging 1.000 phenotype 12/04/2019
62 603204 UTSW Zfp384 0.175 RF011 G1 217.47 N 6 125036476 GGCCCAGGCCCA GGCCCAGGCCCAAGCCCAGGCCCA unclassified Het probably benign phenotype 12/04/2019
63 603228 UTSW Zfp948 0.123 RF011 G1 225.01 N 17 21588312 Y589H T C missense Het probably damaging 0.971 12/04/2019
64 603214 UTSW Zic1 0.930 RF011 G1 225.01 N 9 91364330 I230V T C missense Het probably benign 0.001 phenotype 12/04/2019
[records 1 to 64 of 64]