Incidental Mutations

70 incidental mutations are currently displayed, and affect 69 genes.
10 are Possibly Damaging.
13 are Probably Damaging.
38 are Probably Benign.
8 are Probably Null.
3 create premature stop codons.
5 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 70 of 70] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 603405 UTSW 5430401F13Rik 0.063 RF014 G1 217.47 N 6 131552857 AGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG AGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG small insertion Het probably benign 12/04/2019
2 603422 UTSW 9530003J23Rik 0.056 RF014 G1 225.01 Y 10 117234417 *152Q A G makesense Het probably null 12/04/2019
3 603404 UTSW A2ml1 0.000 RF014 G1 225.01 Y 6 128570068 N366S T C missense Het probably damaging 0.958 12/04/2019
4 603425 UTSW Abca5 0.146 RF014 G1 225.01 Y 11 110279754 T C critical splice acceptor site Het probably null phenotype 12/04/2019
5 603423 UTSW Acaca 1.000 RF014 G1 225.01 Y 11 84231724 V323A T C missense Het probably benign 0.011 phenotype 12/04/2019
6 603400 UTSW Agbl3 0.000 RF014 G1 225.01 Y 6 34799358 D266E T A missense Het possibly damaging 0.533 phenotype 12/04/2019
7 603433 UTSW Aggf1 0.406 RF014 G1 225.01 Y 13 95370768 S170T A T missense Het possibly damaging 0.865 phenotype 12/04/2019
8 603436 UTSW Amhr2 0.804 RF014 G1 225.01 Y 15 102453154 S467C A T missense Het probably benign 0.002 phenotype 12/04/2019
9 603431 UTSW Begain 0.000 RF014 G1 217.49 N 12 109033422 GCCGCC GCCGCCACCGCC unclassified Het probably benign 12/04/2019
10 603421 UTSW Best3 0.105 RF014 G1 225.01 Y 10 117004505 Q280L A T missense Het probably damaging 1.000 phenotype 12/04/2019
11 603448 UTSW Calhm1 0.000 RF014 G1 214.46 N 19 47141265 CTGTGGCTGTGG CTGTGGCTGTGGGTGTGGCTGTGG unclassified Het probably benign phenotype 12/04/2019
12 603449 UTSW Ccdc186 1.000 RF014 G1 225.01 Y 19 56813472 L71S A G missense Het probably benign 0.001 12/04/2019
13 603412 UTSW Ces1d 0.000 RF014 G1 225.01 Y 8 93176165 C A critical splice donor site 1 bp Het probably null phenotype 12/04/2019
14 603429 UTSW Chga 0.073 RF014 G1 160.47 N 12 102561393 AGC AGCGGC small insertion Het probably benign phenotype 12/04/2019
15 603430 UTSW Chga 0.073 RF014 G1 168.47 N 12 102561405 AGC AGCTGC small insertion Het probably benign phenotype 12/04/2019
16 603402 UTSW Clstn3 0.000 RF014 G1 225.01 Y 6 124459266 K212* T A nonsense Het probably null phenotype 12/04/2019
17 603394 UTSW Col16a1 0.118 RF014 G1 214.63 N 4 130093067 TTTTT TTTTTCTTTT critical splice acceptor site Het probably benign phenotype 12/04/2019
18 603409 UTSW Cpxm2 0.082 RF014 G1 225.01 Y 7 132070863 T319K G T missense Het possibly damaging 0.850 12/04/2019
19 603418 UTSW Cyb5r4 0.000 RF014 G1 217.47 N 9 87040415 TGCCCAGGGATGTGACAGACACAC TGCCCAGGGATGTGACAGACACACCGCCCAGGGATGTGACAGACACAC small insertion Het probably benign phenotype 12/04/2019
20 603382 UTSW Dst 0.343 RF014 G1 225.01 Y 1 34247679 S3364P T C missense Het probably benign 0.001 phenotype 12/04/2019
21 603413 UTSW Edc4 1.000 RF014 G1 225.01 Y 8 105884600 T61M C T missense Het probably benign 0.000 phenotype 12/04/2019
22 603393 UTSW Fndc5 0.117 RF014 G1 225.01 Y 4 129142167 H199R A G missense Het probably benign 0.005 phenotype 12/04/2019
23 603399 UTSW Gm43302 0.048 RF014 G1 225.01 Y 5 105274757 I470F T A missense Het possibly damaging 0.945 12/04/2019
24 603392 UTSW Gne 1.000 RF014 G1 225.01 Y 4 44060045 A147D G T missense Het probably damaging 1.000 phenotype 12/04/2019
25 603401 UTSW Igkv12-89 0.121 RF014 G1 181.47 N 6 68835286 G GCAACGCCAC small insertion Het probably benign 12/04/2019
26 603434 UTSW Irf9 0.151 RF014 G1 225.01 Y 14 55605877 R179* C T nonsense Het probably null phenotype 12/04/2019
27 603397 UTSW Jakmip1 0.725 RF014 G1 225.01 Y 5 37174526 K850M A T missense Het possibly damaging 0.587 phenotype 12/04/2019
28 603439 UTSW Kalrn 0.934 RF014 G1 225.01 Y 16 34039933 T1884I G A missense Het probably benign 0.008 phenotype 12/04/2019
29 603383 UTSW Krtap28-10 RF014 G1 217.51 N 1 83042251 CCACCACAGCCACAGCCACCACAGCCACAG CCACCACAGCCACAGACACCACAGCCACAGCCACCACAGCCACAG unclassified Het probably benign 12/04/2019
30 603451 UTSW Las1l RF014 G1 210.47 N X 95940657 CTCCTCCTTCTCCTCTTCCTC CTCCTC small deletion Het probably benign 12/04/2019
31 603416 UTSW Lctl 0.160 RF014 G1 225.01 Y 9 64118930 Y89C A G missense Het probably damaging 1.000 phenotype 12/04/2019
32 603386 UTSW Lpgat1 0.438 RF014 G1 116.49 N 1 191718553 GCC GCCTCC small insertion Het probably benign phenotype 12/04/2019
33 603407 UTSW Luzp2 0.000 RF014 G1 225.01 Y 7 55172205 I157F A T missense Het probably damaging 0.997 phenotype 12/04/2019
34 603450 UTSW Mamld1 RF014 G1 180.47 N X 71118845 GCA GCACCA small insertion Het probably benign phenotype 12/04/2019
35 603387 UTSW Map1a 0.395 RF014 G1 217.47 N 2 121306295 GCTCCAGCTCCAGCTCCAGCTCCA GCTCCAGCTCCAGCTCCAGCTCCAGCTCCACCTCCAGCTCCAGCTCCAGCTCCA small insertion Het probably benign phenotype 12/04/2019
36 603414 UTSW Mbd3l1 0.000 RF014 G1 225.01 Y 9 18485000 E140D A T missense Het possibly damaging 0.479 phenotype 12/04/2019
37 603428 UTSW Mlh3 0.000 RF014 G1 225.01 Y 12 85268029 Q461L T A missense Het probably benign 0.000 phenotype 12/04/2019
38 603417 UTSW Mto1 0.959 RF014 G1 225.01 Y 9 78448316 R7L G T missense Het probably benign 0.003 phenotype 12/04/2019
39 603438 UTSW Muc4 0.103 RF014 G1 225.01 Y 16 32751858 S579C A T missense Het probably damaging 0.976 phenotype 12/04/2019
40 603424 UTSW Ngfr 0.729 RF014 G1 225.01 Y 11 95578201 Y117C T C missense Het probably damaging 1.000 phenotype 12/04/2019
41 603385 UTSW Olfr432 0.067 RF014 G1 225.01 Y 1 174050987 I205F A T missense Het possibly damaging 0.683 phenotype 12/04/2019
42 603410 UTSW Olfr537-ps1 0.148 RF014 G1 225.01 Y 7 140538777 M87L A T missense Het probably benign 0.009 12/04/2019
43 603415 UTSW Olfr926 0.077 RF014 G1 225.01 Y 9 38877900 H241Q C A missense Het probably benign 0.140 phenotype 12/04/2019
44 603396 UTSW Plch2 0.000 RF014 G1 225.01 Y 4 155007120 S179P A G missense Het probably damaging 1.000 phenotype 12/04/2019
45 603390 UTSW Pogz 0.767 RF014 G1 225.01 Y 3 94878247 S838A T G missense Het possibly damaging 0.768 phenotype 12/04/2019
46 603443 UTSW Pot1b 0.000 RF014 G1 225.01 Y 17 55674106 T303S T A missense Het probably benign 0.119 phenotype 12/04/2019
47 603406 UTSW Pou2f2 1.000 RF014 G1 167.01 Y 7 25115737 I72L T A missense Het unknown phenotype 12/04/2019
48 603437 UTSW Ppil2 0.000 RF014 G1 225.01 Y 16 17097418 V109M C T missense Het probably damaging 1.000 phenotype 12/04/2019
49 603384 UTSW Ptpn4 0.246 RF014 G1 225.01 Y 1 119684465 A G critical splice donor site 2 bp Het probably null phenotype 12/04/2019
50 603444 UTSW Ptprs 1.000 RF014 G1 120.01 Y 17 56416935 I1686N A T missense Het probably damaging 1.000 phenotype 12/04/2019
51 603420 UTSW Rfx4 1.000 RF014 G1 217.47 N 10 84858489 CTCTCT CTCTCTCTCTCTCTCTTTCTCT critical splice acceptor site Het probably benign phenotype 12/04/2019
52 603447 UTSW Rnf14 0.661 RF014 G1 225.01 Y 18 38309570 V308E T A missense Het probably damaging 0.999 phenotype 12/04/2019
53 603408 UTSW Setd1a 1.000 RF014 G1 217.47 N 7 127785346 TGGTGGTGG TGGTGGTGGGGGTGGTGG unclassified Het probably benign phenotype 12/04/2019
54 603411 UTSW Sgo2b 0.133 RF014 G1 225.01 Y 8 63931405 T186A T C missense Het possibly damaging 0.944 12/04/2019
55 603445 UTSW Six3 1.000 RF014 G1 188.47 N 17 85621356 CGG CGGTGG small insertion Het probably benign phenotype 12/04/2019
56 603426 UTSW Six4 0.000 RF014 G1 217.47 Y 12 73103582 TG T frame shift Het probably null phenotype 12/04/2019
57 603419 UTSW Stox1 0.289 RF014 G1 225.01 Y 10 62664246 H845L T A missense Het probably benign 0.063 phenotype 12/04/2019
58 603389 UTSW Supt20 0.928 RF014 G1 217.47 N 3 54727665 AGCAGC AGCAGCGGCAGC small insertion Het probably benign phenotype 12/04/2019
59 603398 UTSW Thegl 0.053 RF014 G1 217.47 N 5 77016400 CAGCGATCCTCCCCAGTCCCGCA CAGCGATCCTCCCCAGTCCCGCAGGGCGAGCGATCCTCCCCAGTCCCGCA small insertion Het probably benign 12/04/2019
60 603435 UTSW Trappc9 0.000 RF014 G1 179.47 N 15 72801283 A AGCTGCTGCTGCTGCT small insertion Het probably benign phenotype 12/04/2019
61 603391 UTSW Trim33 1.000 RF014 G1 225.01 Y 3 103329092 V506A T C missense Het possibly damaging 0.942 phenotype 12/04/2019
62 603388 UTSW Uckl1 0.150 RF014 G1 225.01 Y 2 181570194 D373G T C missense Het probably benign 0.000 phenotype 12/04/2019
63 603441 UTSW Vmn2r94 0.106 RF014 G1 225.01 Y 17 18253287 C492* G T nonsense Het probably null 12/04/2019
64 603446 UTSW Wdr33 0.962 RF014 G1 225.01 Y 18 31881273 D396G A G missense Het probably damaging 1.000 phenotype 12/04/2019
65 603440 UTSW Zbtb11 0.973 RF014 G1 189.01 Y 16 55980597 I105L A T missense Het probably damaging 0.970 12/04/2019
66 603395 UTSW Zbtb40 0.145 RF014 G1 213.01 Y 4 137017306 C268S A T missense Het probably benign 0.204 12/04/2019
67 603427 UTSW Zfp36l1 1.000 RF014 G1 225.01 Y 12 80109744 M288L T A missense Het probably benign 0.083 phenotype 12/04/2019
68 603403 UTSW Zfp384 0.188 RF014 G1 217.47 N 6 125036466 CC CCAAGGCCCAGGAC unclassified Het probably benign phenotype 12/04/2019
69 603432 UTSW Zfp72 0.123 RF014 G1 225.01 Y 13 74375054 F15S A G missense Het probably benign 0.167 12/04/2019
70 603442 UTSW Znrd1as 0.156 RF014 G1 217.47 N 17 36965060 CACCACCACCAC CACCACCACCACCACCACCACGACCACCACCAC small insertion Het probably benign 12/04/2019
[records 1 to 70 of 70]