Incidental Mutations

62 incidental mutations are currently displayed, and affect 56 genes.
2 are Possibly Damaging.
11 are Probably Damaging.
39 are Probably Benign.
8 are Probably Null.
1 create premature stop codons.
6 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 62 of 62] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 603455 UTSW 4932438A13Rik 1.000 RF015 G1 214.46 N 3 37050748 TTATTATTATTAT TTATTATTATTATTAGTATTATTATTAT critical splice acceptor site Het probably benign phenotype 12/04/2019
2 603471 UTSW 5430401F13Rik 0.058 RF015 G1 217.47 N 6 131552856 CAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG CAGAAAGGAAAAGGTGGCCAGCAAAAAAAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG small insertion Het probably benign 12/04/2019
3 603472 UTSW 5430401F13Rik 0.058 RF015 G1 217.47 N 6 131552859 AAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG AAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG small insertion Het probably benign 12/04/2019
4 603473 UTSW 5430401F13Rik 0.058 RF015 G1 217.47 N 6 131552861 AGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG AGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG small insertion Het probably benign 12/04/2019
5 603464 UTSW Abcb4 0.000 RF015 G1 106.46 N 5 8896594 GAA G frame shift Het probably null phenotype 12/04/2019
6 603453 UTSW Agap1 0.207 RF015 G1 225.01 N 1 89634263 Y214* T A nonsense Het probably null phenotype 12/04/2019
7 603480 UTSW Arhgap17 0.000 RF015 G1 121.68 N 7 123286862 CTGTTGTTG CTGTTG small deletion Het probably benign phenotype 12/04/2019
8 603460 UTSW Arid1a 1.000 RF015 G1 107.67 N 4 133752831 AGGC A small deletion Het probably benign phenotype 12/04/2019
9 603486 UTSW Bco2 0.062 RF015 G1 225.01 N 9 50545997 F82L A G missense Het probably damaging 1.000 phenotype 12/04/2019
10 603511 UTSW Calhm1 0.000 RF015 G1 217.52 N 19 47141256 TGGCTGTGGCTG TGGCTGTGGCTGGGGCTGTGGCTG unclassified Het probably benign phenotype 12/04/2019
11 603481 UTSW Capn9 0.252 RF015 G1 104.01 N 8 124618482 F683L T C missense Het probably benign 0.004 phenotype 12/04/2019
12 603497 UTSW Cep131 0.942 RF015 G1 214.46 N 11 120072968 CTGTTGTT CTGTTGTTGTT critical splice acceptor site Het probably benign phenotype 12/04/2019
13 603487 UTSW Cgnl1 0.000 RF015 G1 214.46 N 9 71724715 AGCG AGCGGCG small insertion Het probably benign phenotype 12/04/2019
14 603501 UTSW Chga 0.083 RF015 G1 156.47 N 12 102561420 AGC AGCGGC small insertion Het probably benign phenotype 12/04/2019
15 603488 UTSW Cyb5r4 0.000 RF015 G1 217.47 N 9 87040432 GACACA GACACAGTGCCCAAGGATGTGACATACACA small insertion Het probably benign phenotype 12/04/2019
16 603489 UTSW Cyb5r4 0.000 RF015 G1 217.47 N 9 87040438 CTGCCCAGGGA CTGCCCAGGGATGTGACAGACACATTGCCCAGGGA small insertion Het probably benign phenotype 12/04/2019
17 603468 UTSW Dnah10 0.000 RF015 G1 225.01 N 5 124818077 D3557N G A missense Het probably damaging 1.000 phenotype 12/04/2019
18 603483 UTSW Dnmt1 1.000 RF015 G1 217.47 N 9 20910124 GGAGCACAGTTCCTACCTCGTT GGAGCACAGTTCCTACCTCGTTTTGGGGGCTGAGCACAGTTCCTACCTCGTT nonsense Het probably null phenotype 12/04/2019
19 603484 UTSW Dnmt1 1.000 RF015 G1 217.47 N 9 20910129 ACAGTTCCTACCTCGTT ACAGTTCCTACCTCGTTTTGGGGGCGGAGCCCAGTTCCTACCTCGTT nonsense Het probably null phenotype 12/04/2019
20 603462 UTSW Efhd2 0.109 RF015 G1 217.47 N 4 141874756 CCGCCG CCGCCGACGCCG small insertion Het probably benign phenotype 12/04/2019
21 603500 UTSW Exd2 0.103 RF015 G1 217.47 N 12 80475917 AGCAGCCGCAGCC AGCAGCC intron Het probably benign 12/04/2019
22 603498 UTSW Fam49a 0.425 RF015 G1 225.01 N 12 12369938 S294R T A missense Het probably benign 0.000 12/04/2019
23 603478 UTSW Fam71e1 0.087 RF015 G1 217.47 N 7 44500522 TGGGTCTGAGGGAGGA TGGGTCTGAGGGAGGAAGGCTGGATCCTGGATACCGGGGTCTGAGGGAGGA frame shift Het probably null 12/04/2019
24 603463 UTSW Gatad1 0.645 RF015 G1 157.01 N 5 3647523 C33S A T missense Het possibly damaging 0.915 phenotype 12/04/2019
25 603461 UTSW Gm7534 0.065 RF015 G1 225.01 N 4 134193027 H609R T C missense Het probably benign 0.000 12/04/2019
26 603505 UTSW H2-DMb1 0.057 RF015 G1 152.01 N 17 34155502 Y42C A G missense Het probably damaging 1.000 12/04/2019
27 603507 UTSW Hars2 0.953 RF015 G1 225.01 N 18 36785945 R86L G T missense Het probably damaging 0.994 phenotype 12/04/2019
28 603459 UTSW Hsdl2 0.000 RF015 G1 214.46 N 4 59610640 GGAGCAGCCACAGCTGCAGGAGAAGCCACAGCTGCAGGAGCAGCCACAGC GGAGCAGCCACAGCTGCAGGAGCAGCCACAGCTGCAGGAGAAGCCACAGCTGCAGGAGCAGCCACAGC small insertion Het probably benign 12/04/2019
29 603456 UTSW Lce1m RF015 G1 214.46 N 3 93018148 TGCCAC TGCCACTGCTGCGGCCAC unclassified Het probably benign 12/04/2019
30 603475 UTSW Lrmp 0.000 RF015 G1 214.46 N 6 145173783 AGCACATTG AGCACATTGCGCACATTG unclassified Het probably benign phenotype 12/04/2019
31 603482 UTSW Maml2 0.000 RF015 G1 214.46 N 9 13621456 ACAGCAGCAGCAACAGCAGCAGCAGCAGCA ACAGCAACAGCAGCAGCAGCAGCA small deletion Het probably benign 12/04/2019
32 603512 UTSW Mamld1 RF015 G1 144.47 N X 71118820 AGC AGCCGC small insertion Het probably benign phenotype 12/04/2019
33 603513 UTSW Mamld1 RF015 G1 133.47 N X 71118841 AGC AGCCGC small insertion Het probably benign phenotype 12/04/2019
34 603502 UTSW Mast4 0.283 RF015 G1 214.46 N 13 102739247 GGACAAGCTGTGAGTTGGGGAACCCGGGAG GG frame shift Het probably null phenotype 12/04/2019
35 603503 UTSW Mucl2 0.058 RF015 G1 141.01 N 15 103897430 N87I T A missense Het probably benign 0.179 12/04/2019
36 603494 UTSW Myh3 0.681 RF015 G1 217.47 N 11 67086356 ATTAC ATTACTTAC frame shift Het probably null phenotype 12/04/2019
37 603454 UTSW Nup214 1.000 RF015 G1 225.01 N 2 32034706 V1749A T C missense Het probably benign 0.003 phenotype 12/04/2019
38 603479 UTSW Olfr678 0.111 RF015 G1 225.01 N 7 105070048 I194V A G missense Het probably damaging 0.998 phenotype 12/04/2019
39 603508 UTSW Pcdhgb4 0.143 RF015 G1 185.01 N 18 37721802 N417Y A T missense Het probably damaging 1.000 phenotype 12/04/2019
40 603465 UTSW Pclo 0.000 RF015 G1 183.01 N 5 14515269 L16F G T missense Het unknown phenotype 12/04/2019
41 603474 UTSW Pik3c2g 0.098 RF015 G1 225.01 N 6 139754771 N262K T A missense Het phenotype 12/04/2019
42 603477 UTSW Ppp1r13l 0.617 RF015 G1 214.46 N 7 19368542 ACAGGCACCCTGCTCCGGC AC critical splice acceptor site Het probably benign phenotype 12/04/2019
43 603492 UTSW Rfx4 1.000 RF015 G1 217.47 N 10 84858489 CTCTCT CTCTCTCTCTCTCTCTTTCTCT critical splice acceptor site Het probably benign phenotype 12/04/2019
44 603493 UTSW Rnf41 0.000 RF015 G1 225.01 N 10 128435410 A63V C T missense Het probably benign 0.120 phenotype 12/04/2019
45 603491 UTSW Sirt1 1.000 RF015 G1 225.01 N 10 63337016 A163T C T missense Het probably damaging 0.999 phenotype 12/04/2019
46 603506 UTSW Six3 1.000 RF015 G1 204.1 N 17 85621370 GCG GCGTCG small insertion Het probably benign phenotype 12/04/2019
47 603499 UTSW Six4 0.000 RF015 G1 217.47 N 12 73103582 TG T frame shift Het probably null phenotype 12/04/2019
48 603510 UTSW Skor2 1.000 RF015 G1 225.01 N 18 76860788 E735G A G missense Het probably damaging 0.986 phenotype 12/04/2019
49 603504 UTSW Slc26a8 0.569 RF015 G1 164.47 N 17 28638341 TCTCTGGCTCTGGCTCTGGCTCTGGCTC TCTCTGGCTCTGGCTCTGGCTC small deletion Het probably benign phenotype 12/04/2019
50 603476 UTSW Smco2 0.000 RF015 G1 168.46 N 6 146852663 T TTCG small insertion Het probably benign 12/04/2019
51 603496 UTSW Strada 0.508 RF015 G1 225.01 N 11 106171020 I172T A G missense Het probably damaging 0.981 phenotype 12/04/2019
52 603490 UTSW Syne1 1.000 RF015 G1 225.01 N 10 5302248 I2469V T C missense Het probably benign 0.009 phenotype 12/04/2019
53 603509 UTSW Tcof1 1.000 RF015 G1 217.47 N 18 60833584 C CTGCTGAGATGGGCACTTTCCCAGAGCTCCCCTTGGA small insertion Het probably benign phenotype 12/04/2019
54 603452 UTSW Tram1 0.632 RF015 G1 225.01 N 1 13579742 Y86C T C missense Het probably damaging 1.000 phenotype 12/04/2019
55 603458 UTSW Ttll7 0.399 RF015 G1 225.01 N 3 146979658 F882L T A missense Het probably benign 0.003 12/04/2019
56 603485 UTSW Usp2 0.000 RF015 G1 217.47 N 9 44089109 TGTGACCTGTTCTTCACTTAC TGTGACCTGTTCTTCACTTACTCACGTGACCTGTTCTTCACTTAC critical splice acceptor site Het probably benign phenotype 12/04/2019
57 603495 UTSW Utp18 0.967 RF015 G1 205.01 N 11 93885461 L66P A G missense Het probably damaging 1.000 12/04/2019
58 603466 UTSW Wdr66 0.082 RF015 G1 188.54 N 5 123254242 GGAGGAGGAGGAG GGAGGAGGAGGAGGAG small insertion Het probably benign phenotype 12/04/2019
59 603467 UTSW Wdr66 0.082 RF015 G1 154.47 N 5 123274161 TCTCA T critical splice acceptor site Het probably benign phenotype 12/04/2019
60 603469 UTSW Wnt7a 0.686 RF015 G1 225.01 N 6 91394423 E186K C T missense Het possibly damaging 0.810 phenotype 12/04/2019
61 603470 UTSW Zfp384 0.186 RF015 G1 217.64 N 6 125036481 AGGCCCAGGCCC AGGCCCAGGCCCCGGCCCAGGCCC unclassified Het probably benign phenotype 12/04/2019
62 603457 UTSW Zgrf1 0.104 RF015 G1 225.01 N 3 127563233 I703V A G missense Het probably benign 0.023 12/04/2019
[records 1 to 62 of 62]