Incidental Mutations

91 incidental mutations are currently displayed, and affect 89 genes.
10 are Possibly Damaging.
22 are Probably Damaging.
39 are Probably Benign.
15 are Probably Null.
1 create premature stop codons.
4 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 91 of 91] per page Full List
ID question?
Source question?
Gene question?
E-score question?
Stock # question?
Gen question?
Vld question?
Strain question?
Chr question?
Position question?
Mutation question?
Type question?
Exon Dist question?
Zygosity question?
Predicted Effect question?
PPH Score question?
Meta Score question?
MGI Phenotype question?
Posted question?
1 603812 UTSW Abca16 0.000 RF020 G1 225.01 N 7 120533657 K1270E A G missense Het possibly damaging 0.902 12/04/2019
2 603780 UTSW Adgrb2 0.000 RF020 G1 225.01 N 4 130010084 S668P T C missense Het probably damaging 0.998 phenotype 12/04/2019
3 603781 UTSW Ahdc1 0.279 RF020 G1 225.01 N 4 133064277 L943R T G missense Het possibly damaging 0.956 phenotype 12/04/2019
4 603775 UTSW Ank2 1.000 RF020 G1 225.01 N 3 126945476 K2253R T C missense Het unknown phenotype 12/04/2019
5 603827 UTSW Arhgap23 0.000 RF020 G1 157.01 N 11 97463561 S767P T C missense Het probably damaging 0.999 phenotype 12/04/2019
6 603816 UTSW Arhgef12 0.944 RF020 G1 225.01 N 9 42989989 I839T A G missense Het possibly damaging 0.754 phenotype 12/04/2019
7 603831 UTSW Begain 0.000 RF020 G1 213.48 N 12 109033424 CGCCGC CGCCGCGGCCGC unclassified Het probably benign 12/04/2019
8 603779 UTSW Btbd19 0.139 RF020 G1 225.01 N 4 117122275 C116S A T missense Het probably damaging 0.995 12/04/2019
9 603843 UTSW Cbr1 0.148 RF020 G1 225.01 N 16 93610179 A261V C T missense Het probably benign 0.001 phenotype 12/04/2019
10 603829 UTSW Ccdc137 1.000 RF020 G1 225.01 N 11 120458196 R18G A G missense Het probably benign 0.000 12/04/2019
11 603846 UTSW Cdsn 1.000 RF020 G1 179.46 N 17 35554979 AG AGACAGGAAGTAGTAGCTCTCAG small insertion Het probably benign phenotype 12/04/2019
12 603819 UTSW Celsr3 1.000 RF020 G1 225.01 N 9 108849057 R3162C C T missense Het probably benign 0.000 phenotype 12/04/2019
13 603767 UTSW Cep350 0.967 RF020 G1 225.01 N 1 155915478 V1300E A T missense Het probably benign 0.336 phenotype 12/04/2019
14 603826 UTSW Cluh 0.294 RF020 G1 201.87 N 11 74669538 G GCCAGAT small insertion Het probably benign phenotype 12/04/2019
15 603833 UTSW Cmya5 0.321 RF020 G1 225.01 N 13 93069291 Q3357K G T missense Het possibly damaging 0.555 12/04/2019
16 603822 UTSW Col6a2 0.000 RF020 G1 225.01 N 10 76606209 T G critical splice acceptor site Het probably null phenotype 12/04/2019
17 603778 UTSW Cyp2j9 0.068 RF020 G1 225.01 N 4 96577652 T315S T A missense Het probably damaging 0.998 12/04/2019
18 603789 UTSW Cyp3a13 0.000 RF020 G1 163.46 N 5 137894263 CATTATT CATT makesense Het probably null phenotype 12/04/2019
19 603797 UTSW Dnah6 0.135 RF020 G1 225.01 N 6 73118057 Y2181F T A missense Het probably benign 0.004 phenotype 12/04/2019
20 603763 UTSW Dnah7b 0.095 RF020 G1 225.01 N 1 46373261 D4010G A G missense Het possibly damaging 0.843 12/04/2019
21 603844 UTSW E4f1 1.000 RF020 G1 199.57 N 17 24455195 CCG CCGACG unclassified Het probably benign phenotype 12/04/2019
22 603838 UTSW Ep300 1.000 RF020 G1 225.01 N 15 81586571 A T start gained Het probably benign phenotype 12/04/2019
23 603845 UTSW Fam234a 0.073 RF020 G1 225.01 N 17 26218751 V90A A G missense Het probably benign 0.424 12/04/2019
24 603807 UTSW Fam71e1 0.095 RF020 G1 217.47 N 7 44500535 GGA GGAAGGGTGGATCCTGGATACCTGGGTCTGAGGGAAGA frame shift Het probably null 12/04/2019
25 603853 UTSW Gab3 0.000 RF020 G1 131.47 N X 75000017 TCT TCTGCT small insertion Het probably benign phenotype 12/04/2019
26 603824 UTSW Gal3st1 0.000 RF020 G1 225.01 N 11 3998153 Y120C A G missense Het possibly damaging 0.753 phenotype 12/04/2019
27 603841 UTSW Gm5475 0.214 RF020 G1 217.47 N 15 100427149 GTGGAAGGAAAGGT G frame shift Het probably null 12/04/2019
28 603849 UTSW Gm6665 RF020 G1 214.46 N 18 31820377 T TC frame shift Het probably null 12/04/2019
29 603765 UTSW Hdlbp 0.913 RF020 G1 225.01 N 1 93440734 T8A T C missense Het probably benign 0.000 phenotype 12/04/2019
30 603793 UTSW Hnrnpa2b1 0.960 RF020 G1 225.01 N 6 51466694 K92N T A missense Het probably damaging 0.993 phenotype 12/04/2019
32 603828 UTSW Klhl10 0.650 RF020 G1 225.01 N 11 100442070 Q14E C G missense Het probably benign 0.000 phenotype 12/04/2019
33 603802 UTSW Klra2 0.052 RF020 G1 214.46 N 6 131221838 GAAAGAAATCCA GAAAGAAATCCAAAGAAATCCA frame shift Het probably null phenotype 12/04/2019
34 603806 UTSW Kmt2b 1.000 RF020 G1 217.47 N 7 30586382 CC CCTCCTGC unclassified Het probably benign phenotype 12/04/2019
35 603842 UTSW Krt2 0.105 RF020 G1 225.01 N 15 101817968 I45T A G missense Het unknown phenotype 12/04/2019
36 603787 UTSW Ksr2 0.150 RF020 G1 225.01 N 5 117555218 S244P T C missense Het probably benign 0.000 phenotype 12/04/2019
37 603772 UTSW Lama5 1.000 RF020 G1 225.01 N 2 180196178 M915K A T missense Het probably benign 0.000 phenotype 12/04/2019
38 603770 UTSW Lrp1b 0.000 RF020 G1 225.01 N 2 41770846 H197Q A C missense Het phenotype 12/04/2019
39 603818 UTSW Lrrc1 0.208 RF020 G1 225.01 N 9 77452631 E293G T C missense Het probably damaging 1.000 12/04/2019
40 603773 UTSW Med12l 0.386 RF020 G1 165.47 N 3 59275958 AACA AACAACA small insertion Het probably benign phenotype 12/04/2019
41 603791 UTSW Mgam 0.088 RF020 G1 225.01 N 6 40685309 Y1179N T A missense Het probably damaging 1.000 phenotype 12/04/2019
42 603823 UTSW Mgat4c 0.000 RF020 G1 225.01 N 10 102389067 I381V A G missense Het probably benign 0.000 12/04/2019
43 603808 UTSW Mrgprx1 0.000 RF020 G1 204.47 N 7 48021511 A AGAC small insertion Het probably benign 12/04/2019
44 603837 UTSW Myc 1.000 RF020 G1 175.01 N 15 61985823 A T unclassified Het probably benign phenotype 12/04/2019
45 603835 UTSW Nipbl 0.967 RF020 G1 225.01 N 15 8358934 S401P A G missense Het probably damaging 0.975 phenotype 12/04/2019
46 603805 UTSW Nlrp9c 0.000 RF020 G1 225.01 N 7 26385224 I310N A T missense Het probably benign 0.000 12/04/2019
47 603784 UTSW Nwd2 0.150 RF020 G1 225.01 N 5 63805723 Y883* C A nonsense Het probably null 12/04/2019
48 603788 UTSW Oas1e 0.061 RF020 G1 225.01 N 5 120794318 T87S T A missense Het possibly damaging 0.577 12/04/2019
49 603810 UTSW Olfr586 0.147 RF020 G1 225.01 N 7 103121891 C294S A T missense Het probably benign 0.045 phenotype 12/04/2019
50 603811 UTSW Olfr653 0.070 RF020 G1 225.01 N 7 104580290 M215V A G missense Het probably benign 0.002 phenotype 12/04/2019
51 603814 UTSW Olfr885 0.073 RF020 G1 216.01 N 9 38061324 M1I G A start codon destroyed Het probably null 0.014 phenotype 12/04/2019
52 603815 UTSW Olfr964-ps1 0.218 RF020 G1 214.46 N 9 39686753 GA GATACA frame shift Het probably null 12/04/2019
53 603777 UTSW Pappa 0.706 RF020 G1 225.01 N 4 65205045 S872R T G missense Het possibly damaging 0.770 phenotype 12/04/2019
54 603834 UTSW Parp4 0.133 RF020 G1 225.01 N 14 56647349 L1295P T C missense Het unknown phenotype 12/04/2019
55 603821 UTSW Pcdh15 0.000 RF020 G1 225.01 N 10 74185410 Y152F A T missense Het probably damaging 1.000 phenotype 12/04/2019
56 603771 UTSW Pdk1 0.000 RF020 G1 225.01 N 2 71883896 I217L A T missense Het possibly damaging 0.839 phenotype 12/04/2019
57 603817 UTSW Phldb1 0.125 RF020 G1 225.01 N 9 44697946 C450W A C missense Het probably damaging 1.000 12/04/2019
58 603804 UTSW Pnmal1 0.076 RF020 G1 217.47 N 7 16961451 C CCATGATGCACCTGCTTCAACATCA small insertion Het probably benign 12/04/2019
59 603832 UTSW Prl2c5 0.119 RF020 G1 225.01 N 13 13185912 G55S G A missense Het probably benign 0.281 12/04/2019
60 603825 UTSW Psme2b 0.166 RF020 G1 225.01 N 11 48945570 H183Q A T missense Het probably damaging 0.972 phenotype 12/04/2019
61 603799 UTSW Ptms RF020 G1 214.46 N 6 124914449 CCTCCTC CCTCCTCCTC unclassified Het probably benign 12/04/2019
62 603813 UTSW Rln3 RF020 G1 225.01 N 8 84043302 T73A T C missense Het probably benign 0.006 phenotype 12/04/2019
63 603848 UTSW Rprd1a 0.000 RF020 G1 225.01 N 18 24530005 Q21L T A missense Het probably damaging 0.995 phenotype 12/04/2019
64 603839 UTSW Sept3 0.111 RF020 G1 225.01 N 15 82284461 D155V A T missense Het probably damaging 1.000 phenotype 12/04/2019
65 603820 UTSW Sh3rf3 0.212 RF020 G1 225.01 N 10 58813768 V65E T A missense Het probably damaging 0.988 12/04/2019
66 603840 UTSW Shank3 0.250 RF020 G1 225.01 N 15 89500390 N155S A G missense Het probably benign 0.200 phenotype 12/04/2019
67 603774 UTSW Shox2 1.000 RF020 G1 225.01 N 3 66973813 P278Q G T missense Het probably damaging 0.999 phenotype 12/04/2019
68 603851 UTSW Slc1a1 0.000 RF020 G1 225.01 N 19 28879155 T C critical splice donor site 2 bp Het probably null phenotype 12/04/2019
69 603764 UTSW Slc39a10 0.607 RF020 G1 225.01 N 1 46810015 F814I A T missense Het probably damaging 0.994 phenotype 12/04/2019
70 603782 UTSW Slc5a1 0.174 RF020 G1 225.01 N 5 33133429 I119T T C missense Het probably damaging 0.999 phenotype 12/04/2019
71 603798 UTSW Slc6a13 0.309 RF020 G1 225.01 N 6 121324351 T C critical splice donor site 2 bp Het probably null phenotype 12/04/2019
72 603768 UTSW Spta1 0.833 RF020 G1 225.01 N 1 174213444 D1270G A G missense Het probably benign 0.423 phenotype 12/04/2019
73 603769 UTSW Spta1 0.833 RF020 G1 225.01 N 1 174217903 F1542L T A missense Het probably damaging 0.999 phenotype 12/04/2019
74 603783 UTSW Tacc3 1.000 RF020 G1 225.01 N 5 33661224 M1K T A start codon destroyed Het probably null 0.533 phenotype 12/04/2019
75 603794 UTSW Tax1bp1 0.107 RF020 G1 225.01 N 6 52721354 V17A T C missense Het probably damaging 1.000 phenotype 12/04/2019
76 603786 UTSW Thegl 0.055 RF020 G1 217.47 N 5 77016400 CAGCGATCCTCCCCAGTCCCGCAAGGC CAGCGATCCTCCCCAGTCCCGCAAGGCGAGCGATCCTCCCCAGTCCCGCAAGGC small insertion Het probably benign 12/04/2019
77 603785 UTSW Tmem156 0.052 RF020 G1 225.01 N 5 65091547 E3D T A missense Het probably benign 0.336 12/04/2019
78 603790 UTSW Tmem209 0.782 RF020 G1 225.01 N 6 30487418 M530L T A missense Het probably benign 0.039 12/04/2019
79 603809 UTSW Trpc2 0.000 RF020 G1 225.01 N 7 102096226 D883G A G missense Het unknown phenotype 12/04/2019
80 603803 UTSW Tsen34 0.928 RF020 G1 217.47 N 7 3695796 GGAGCCAAAAT G frame shift Het probably null phenotype 12/04/2019
81 603852 UTSW Uhrf2 0.727 RF020 G1 225.01 N 19 30086391 Y585H T C missense Het probably damaging 1.000 phenotype 12/04/2019
82 603795 UTSW Vmn1r26 0.055 RF020 G1 225.01 N 6 58008720 K161N T A missense Het probably benign 0.350 12/04/2019
83 603796 UTSW Vmn1r29 0.066 RF020 G1 225.01 N 6 58307543 S83G A G missense Het probably benign 0.012 12/04/2019
84 603836 UTSW Vps13b 0.000 RF020 G1 225.01 N 15 35925406 W3829L G T missense Het probably null 0.998 phenotype 12/04/2019
85 603850 UTSW Vwce 0.059 RF020 G1 225.01 N 19 10653085 G503R G A missense Het probably damaging 1.000 12/04/2019
86 603766 UTSW Zc3h11a 1.000 RF020 G1 225.01 N 1 133626997 E415G T C missense Het possibly damaging 0.895 12/04/2019
87 603830 UTSW Zc3h14 0.000 RF020 G1 225.01 N 12 98780282 T A critical splice donor site 2 bp Het probably null phenotype 12/04/2019
88 603847 UTSW Zfp119b 0.065 RF020 G1 225.01 N 17 55939499 M229K A T missense Het probably benign 0.001 12/04/2019
89 603800 UTSW Zfp384 0.185 RF020 G1 117.47 N 6 125036455 CCAAGCTCAAGC CCAAGC unclassified Het probably benign phenotype 12/04/2019
90 603801 UTSW Zfp384 0.185 RF020 G1 214.97 N 6 125036488 GGCCCAGGC GGCCCAGGCCCACGCCCAGGC unclassified Het probably benign phenotype 12/04/2019
91 603792 UTSW Zyx 0.000 RF020 G1 225.01 N 6 42357396 L518Q T A missense Het probably damaging 1.000 phenotype 12/04/2019
[records 1 to 91 of 91]