Incidental Mutations

91 incidental mutations are currently displayed, and affect 89 genes.
10 are Possibly Damaging.
22 are Probably Damaging.
39 are Probably Benign.
15 are Probably Null.
1 create premature stop codons.
4 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 91 of 91] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 603812 UTSW Abca16 0.000 RF020 G1 225.01 N 7 120533657 K1270E A G missense Het possibly damaging 0.902 12/04/2019
2 603780 UTSW Adgrb2 0.000 RF020 G1 225.01 N 4 130010084 S668P T C missense Het probably damaging 0.998 phenotype 12/04/2019
3 603781 UTSW Ahdc1 0.261 RF020 G1 225.01 N 4 133064277 L943R T G missense Het possibly damaging 0.956 phenotype 12/04/2019
4 603775 UTSW Ank2 1.000 RF020 G1 225.01 N 3 126945476 K2253R T C missense Het unknown phenotype 12/04/2019
5 603827 UTSW Arhgap23 0.000 RF020 G1 157.01 N 11 97463561 S767P T C missense Het probably damaging 0.999 phenotype 12/04/2019
6 603816 UTSW Arhgef12 0.943 RF020 G1 225.01 N 9 42989989 I839T A G missense Het possibly damaging 0.754 phenotype 12/04/2019
7 603831 UTSW Begain 0.000 RF020 G1 213.48 N 12 109033424 CGCCGC CGCCGCGGCCGC unclassified Het probably benign 12/04/2019
8 603779 UTSW Btbd19 0.133 RF020 G1 225.01 N 4 117122275 C116S A T missense Het probably damaging 0.995 12/04/2019
9 603843 UTSW Cbr1 0.150 RF020 G1 225.01 N 16 93610179 A261V C T missense Het probably benign 0.001 phenotype 12/04/2019
10 603829 UTSW Ccdc137 1.000 RF020 G1 225.01 N 11 120458196 R18G A G missense Het probably benign 0.000 12/04/2019
11 603846 UTSW Cdsn 1.000 RF020 G1 179.46 N 17 35554979 AG AGACAGGAAGTAGTAGCTCTCAG small insertion Het probably benign phenotype 12/04/2019
12 603819 UTSW Celsr3 1.000 RF020 G1 225.01 N 9 108849057 R3162C C T missense Het probably benign 0.000 phenotype 12/04/2019
13 603767 UTSW Cep350 0.961 RF020 G1 225.01 N 1 155915478 V1300E A T missense Het probably benign 0.336 phenotype 12/04/2019
14 603826 UTSW Cluh 0.236 RF020 G1 201.87 N 11 74669538 G GCCAGAT small insertion Het probably benign phenotype 12/04/2019
15 603833 UTSW Cmya5 0.190 RF020 G1 225.01 N 13 93069291 Q3357K G T missense Het possibly damaging 0.555 12/04/2019
16 603822 UTSW Col6a2 0.000 RF020 G1 225.01 N 10 76606209 T G critical splice acceptor site Het probably null phenotype 12/04/2019
17 603778 UTSW Cyp2j9 0.068 RF020 G1 225.01 N 4 96577652 T315S T A missense Het probably damaging 0.998 12/04/2019
18 603789 UTSW Cyp3a13 0.000 RF020 G1 163.46 N 5 137894263 CATTATT CATT makesense Het probably null phenotype 12/04/2019
19 603797 UTSW Dnah6 0.095 RF020 G1 225.01 N 6 73118057 Y2181F T A missense Het probably benign 0.004 phenotype 12/04/2019
20 603763 UTSW Dnah7b 0.155 RF020 G1 225.01 N 1 46373261 D4010G A G missense Het possibly damaging 0.843 12/04/2019
21 603844 UTSW E4f1 1.000 RF020 G1 199.57 N 17 24455195 CCG CCGACG unclassified Het probably benign phenotype 12/04/2019
22 603838 UTSW Ep300 1.000 RF020 G1 225.01 N 15 81586571 A T start gained Het probably benign phenotype 12/04/2019
23 603845 UTSW Fam234a 0.087 RF020 G1 225.01 N 17 26218751 V90A A G missense Het probably benign 0.424 12/04/2019
24 603807 UTSW Fam71e1 0.087 RF020 G1 217.47 N 7 44500535 GGA GGAAGGGTGGATCCTGGATACCTGGGTCTGAGGGAAGA frame shift Het probably null 12/04/2019
25 603853 UTSW Gab3 0.000 RF020 G1 131.47 N X 75000017 TCT TCTGCT small insertion Het probably benign phenotype 12/04/2019
26 603824 UTSW Gal3st1 0.000 RF020 G1 225.01 N 11 3998153 Y120C A G missense Het possibly damaging 0.753 phenotype 12/04/2019
27 603841 UTSW Gm5475 0.159 RF020 G1 217.47 N 15 100427149 GTGGAAGGAAAGGT G frame shift Het probably null 12/04/2019
28 603849 UTSW Gm6665 RF020 G1 214.46 N 18 31820377 T TC frame shift Het probably null 12/04/2019
29 603765 UTSW Hdlbp 0.894 RF020 G1 225.01 N 1 93440734 T8A T C missense Het probably benign 0.000 phenotype 12/04/2019
30 603793 UTSW Hnrnpa2b1 0.948 RF020 G1 225.01 N 6 51466694 K92N T A missense Het probably damaging 0.993 phenotype 12/04/2019
31 603776 UTSW Hsdl2 0.000 RF020 G1 214.46 N 4 59610640 GGAGCAGCCACAGCTGCAGGAGAAGCCACAGCTGCAGGAGCAGCCACAGC GGAGCAGCCACAGCTGCAGGAGCAGCCACAGCTGCAGGAGAAGCCACAGCTGCAGGAGCAGCCACAGC small insertion Het probably benign 12/04/2019
32 603828 UTSW Klhl10 0.434 RF020 G1 225.01 N 11 100442070 Q14E C G missense Het probably benign 0.000 phenotype 12/04/2019
33 603802 UTSW Klra2 0.057 RF020 G1 214.46 N 6 131221838 GAAAGAAATCCA GAAAGAAATCCAAAGAAATCCA frame shift Het probably null phenotype 12/04/2019
34 603806 UTSW Kmt2b 1.000 RF020 G1 217.47 N 7 30586382 CC CCTCCTGC unclassified Het probably benign phenotype 12/04/2019
35 603842 UTSW Krt2 0.141 RF020 G1 225.01 N 15 101817968 I45T A G missense Het unknown phenotype 12/04/2019
36 603787 UTSW Ksr2 0.169 RF020 G1 225.01 N 5 117555218 S244P T C missense Het probably benign 0.000 phenotype 12/04/2019
37 603772 UTSW Lama5 1.000 RF020 G1 225.01 N 2 180196178 M915K A T missense Het probably benign 0.000 phenotype 12/04/2019
38 603770 UTSW Lrp1b 0.000 RF020 G1 225.01 N 2 41770846 H197Q A C missense Het phenotype 12/04/2019
39 603818 UTSW Lrrc1 0.198 RF020 G1 225.01 N 9 77452631 E293G T C missense Het probably damaging 1.000 12/04/2019
40 603773 UTSW Med12l 0.274 RF020 G1 165.47 N 3 59275958 AACA AACAACA small insertion Het probably benign phenotype 12/04/2019
41 603791 UTSW Mgam 0.085 RF020 G1 225.01 N 6 40685309 Y1179N T A missense Het probably damaging 1.000 phenotype 12/04/2019
42 603823 UTSW Mgat4c 0.000 RF020 G1 225.01 N 10 102389067 I381V A G missense Het probably benign 0.000 12/04/2019
43 603808 UTSW Mrgprx1 0.000 RF020 G1 204.47 N 7 48021511 A AGAC small insertion Het probably benign 12/04/2019
44 603837 UTSW Myc 1.000 RF020 G1 175.01 N 15 61985823 A T unclassified Het probably benign phenotype 12/04/2019
45 603835 UTSW Nipbl 0.962 RF020 G1 225.01 N 15 8358934 S401P A G missense Het probably damaging 0.975 phenotype 12/04/2019
46 603805 UTSW Nlrp9c 0.000 RF020 G1 225.01 N 7 26385224 I310N A T missense Het probably benign 0.000 12/04/2019
47 603784 UTSW Nwd2 0.114 RF020 G1 225.01 N 5 63805723 Y883* C A nonsense Het probably null 12/04/2019
48 603788 UTSW Oas1e 0.064 RF020 G1 225.01 N 5 120794318 T87S T A missense Het possibly damaging 0.577 12/04/2019
49 603810 UTSW Olfr586 0.146 RF020 G1 225.01 N 7 103121891 C294S A T missense Het probably benign 0.045 phenotype 12/04/2019
50 603811 UTSW Olfr653 0.074 RF020 G1 225.01 N 7 104580290 M215V A G missense Het probably benign 0.002 phenotype 12/04/2019
51 603814 UTSW Olfr885 0.077 RF020 G1 216.01 N 9 38061324 M1I G A start codon destroyed Het probably null 0.014 phenotype 12/04/2019
52 603815 UTSW Olfr964-ps1 0.214 RF020 G1 214.46 N 9 39686753 GA GATACA frame shift Het probably null 12/04/2019
53 603777 UTSW Pappa 0.618 RF020 G1 225.01 N 4 65205045 S872R T G missense Het possibly damaging 0.770 phenotype 12/04/2019
54 603834 UTSW Parp4 0.156 RF020 G1 225.01 N 14 56647349 L1295P T C missense Het unknown phenotype 12/04/2019
55 603821 UTSW Pcdh15 0.000 RF020 G1 225.01 N 10 74185410 Y152F A T missense Het probably damaging 1.000 phenotype 12/04/2019
56 603771 UTSW Pdk1 0.000 RF020 G1 225.01 N 2 71883896 I217L A T missense Het possibly damaging 0.839 phenotype 12/04/2019
57 603817 UTSW Phldb1 0.116 RF020 G1 225.01 N 9 44697946 C450W A C missense Het probably damaging 1.000 12/04/2019
58 603804 UTSW Pnmal1 0.067 RF020 G1 217.47 N 7 16961451 C CCATGATGCACCTGCTTCAACATCA small insertion Het probably benign 12/04/2019
59 603832 UTSW Prl2c5 0.095 RF020 G1 225.01 N 13 13185912 G55S G A missense Het probably benign 0.281 12/04/2019
60 603825 UTSW Psme2b 0.174 RF020 G1 225.01 N 11 48945570 H183Q A T missense Het probably damaging 0.972 phenotype 12/04/2019
61 603799 UTSW Ptms RF020 G1 214.46 N 6 124914449 CCTCCTC CCTCCTCCTC unclassified Het probably benign 12/04/2019
62 603813 UTSW Rln3 RF020 G1 225.01 N 8 84043302 T73A T C missense Het probably benign 0.006 phenotype 12/04/2019
63 603848 UTSW Rprd1a 0.000 RF020 G1 225.01 N 18 24530005 Q21L T A missense Het probably damaging 0.995 phenotype 12/04/2019
64 603839 UTSW Sept3 0.161 RF020 G1 225.01 N 15 82284461 D155V A T missense Het probably damaging 1.000 phenotype 12/04/2019
65 603820 UTSW Sh3rf3 0.157 RF020 G1 225.01 N 10 58813768 V65E T A missense Het probably damaging 0.988 12/04/2019
66 603840 UTSW Shank3 0.249 RF020 G1 225.01 N 15 89500390 N155S A G missense Het probably benign 0.200 phenotype 12/04/2019
67 603774 UTSW Shox2 1.000 RF020 G1 225.01 N 3 66973813 P278Q G T missense Het probably damaging 0.999 phenotype 12/04/2019
68 603851 UTSW Slc1a1 0.000 RF020 G1 225.01 N 19 28879155 T C critical splice donor site 2 bp Het probably null phenotype 12/04/2019
69 603764 UTSW Slc39a10 0.682 RF020 G1 225.01 N 1 46810015 F814I A T missense Het probably damaging 0.994 phenotype 12/04/2019
70 603782 UTSW Slc5a1 0.150 RF020 G1 225.01 N 5 33133429 I119T T C missense Het probably damaging 0.999 phenotype 12/04/2019
71 603798 UTSW Slc6a13 0.343 RF020 G1 225.01 N 6 121324351 T C critical splice donor site 2 bp Het probably null phenotype 12/04/2019
72 603768 UTSW Spta1 0.758 RF020 G1 225.01 N 1 174213444 D1270G A G missense Het probably benign 0.423 phenotype 12/04/2019
73 603769 UTSW Spta1 0.758 RF020 G1 225.01 N 1 174217903 F1542L T A missense Het probably damaging 0.999 phenotype 12/04/2019
74 603783 UTSW Tacc3 1.000 RF020 G1 225.01 N 5 33661224 M1K T A start codon destroyed Het probably null 0.533 phenotype 12/04/2019
75 603794 UTSW Tax1bp1 0.181 RF020 G1 225.01 N 6 52721354 V17A T C missense Het probably damaging 1.000 phenotype 12/04/2019
76 603786 UTSW Thegl 0.075 RF020 G1 217.47 N 5 77016400 CAGCGATCCTCCCCAGTCCCGCAAGGC CAGCGATCCTCCCCAGTCCCGCAAGGCGAGCGATCCTCCCCAGTCCCGCAAGGC small insertion Het probably benign 12/04/2019
77 603785 UTSW Tmem156 0.061 RF020 G1 225.01 N 5 65091547 E3D T A missense Het probably benign 0.336 12/04/2019
78 603790 UTSW Tmem209 0.680 RF020 G1 225.01 N 6 30487418 M530L T A missense Het probably benign 0.039 12/04/2019
79 603809 UTSW Trpc2 0.000 RF020 G1 225.01 N 7 102096226 D883G A G missense Het unknown phenotype 12/04/2019
80 603803 UTSW Tsen34 0.892 RF020 G1 217.47 N 7 3695796 GGAGCCAAAAT G frame shift Het probably null phenotype 12/04/2019
81 603852 UTSW Uhrf2 0.699 RF020 G1 225.01 N 19 30086391 Y585H T C missense Het probably damaging 1.000 phenotype 12/04/2019
82 603795 UTSW Vmn1r26 0.066 RF020 G1 225.01 N 6 58008720 K161N T A missense Het probably benign 0.350 12/04/2019
83 603796 UTSW Vmn1r29 0.072 RF020 G1 225.01 N 6 58307543 S83G A G missense Het probably benign 0.012 12/04/2019
84 603836 UTSW Vps13b 0.000 RF020 G1 225.01 N 15 35925406 W3829L G T missense Het probably null 0.998 phenotype 12/04/2019
85 603850 UTSW Vwce 0.082 RF020 G1 225.01 N 19 10653085 G503R G A missense Het probably damaging 1.000 12/04/2019
86 603766 UTSW Zc3h11a 1.000 RF020 G1 225.01 N 1 133626997 E415G T C missense Het possibly damaging 0.895 12/04/2019
87 603830 UTSW Zc3h14 0.000 RF020 G1 225.01 N 12 98780282 T A critical splice donor site 2 bp Het probably null phenotype 12/04/2019
88 603847 UTSW Zfp119b 0.059 RF020 G1 225.01 N 17 55939499 M229K A T missense Het probably benign 0.001 12/04/2019
89 603800 UTSW Zfp384 0.262 RF020 G1 117.47 N 6 125036455 CCAAGCTCAAGC CCAAGC unclassified Het probably benign phenotype 12/04/2019
90 603801 UTSW Zfp384 0.262 RF020 G1 214.97 N 6 125036488 GGCCCAGGC GGCCCAGGCCCACGCCCAGGC unclassified Het probably benign phenotype 12/04/2019
91 603792 UTSW Zyx 0.000 RF020 G1 225.01 N 6 42357396 L518Q T A missense Het probably damaging 1.000 phenotype 12/04/2019
[records 1 to 91 of 91]