Incidental Mutations

53 incidental mutations are currently displayed, and affect 52 genes.
7 are Possibly Damaging.
12 are Probably Damaging.
28 are Probably Benign.
5 are Probably Null.
2 create premature stop codons.
4 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 53 of 53] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 603867 UTSW 4932438A13Rik 1.000 RF021 G1 217.73 N 3 37050748 (GRCm38) TTATTATTATTAT TTATTATTATTATTAATATTATTATTAT critical splice acceptor site Het probably benign phenotype 2019-12-04
2 603859 UTSW A030005L19Rik RF021 G1 199.72 N 1 82913569 (GRCm38) GTGGTGGCTG GTGGTGGCTGTGGTGGCTG small insertion Het probably benign 2019-12-04
3 603910 UTSW AI837181 0.000 RF021 G1 128.47 N 19 5425234 (GRCm38) CGG CGGTGG small insertion Het probably benign 2019-12-04
4 603855 UTSW Ankrd44 0.151 RF021 G1 225.01 Y 1 54778312 (GRCm38) H79R T C missense Het probably damaging 0.999 2019-12-04
5 603857 UTSW Atg9a 1.000 RF021 G1 225.01 Y 1 75182629 (GRCm38) E826V T A missense Het probably damaging 0.963 0.076 phenotype 2019-12-04
6 603914 UTSW Atrnl1 0.220 RF021 G1 225.01 Y 19 57642473 (GRCm38) V224A T C missense Het probably benign 0.003 0.070 phenotype 2019-12-04
7 603903 UTSW Cpn2 0.052 RF021 G1 225.01 Y 16 30259338 (GRCm38) A515V G A missense Het probably benign 0.000 2019-12-04
8 603879 UTSW Cyp2a12 0.071 RF021 G1 225.01 Y 7 27035360 (GRCm38) F402S T C missense Het possibly damaging 0.731 2019-12-04
9 603865 UTSW Defb22 0.000 RF021 G1 214.46 N 2 152485832 (GRCm38) TGCGGCA TGCGGCAGAGCTGGGCGTTGCGGCA small insertion Het probably benign 2019-12-04
10 603860 UTSW Diexf 0.970 RF021 G1 225.01 Y 1 193120666 (GRCm38) F248L A G missense Het probably benign 0.000 2019-12-04
11 603877 UTSW Dnah10 0.000 RF021 G1 225.01 Y 5 124777907 (GRCm38) V2016F G T missense Het probably damaging 1.000 phenotype 2019-12-04
12 603858 UTSW Dock10 0.303 RF021 G1 218.01 Y 1 80564573 (GRCm38) T C critical splice acceptor site Het probably null 0.949 phenotype 2019-12-04
13 603874 UTSW Efhd2 0.142 RF021 G1 214.46 N 4 141874773 (GRCm38) GCC GCCGCCCCC small insertion Het probably benign phenotype 2019-12-04
14 603902 UTSW Fam131a 0.086 RF021 G1 128.01 Y 16 20694940 (GRCm38) A C intron Het probably benign 2019-12-04
15 603878 UTSW Gm6614 0.056 RF021 G1 225.01 Y 6 142008714 (GRCm38) V31E A T missense Het probably damaging 0.984 2019-12-04
16 603898 UTSW Gm7247 0.144 RF021 G1 214.46 N 14 51364324 (GRCm38) AGACCAGACC A small deletion Het probably benign 2019-12-04
17 603895 UTSW Gna13 1.000 RF021 G1 225.01 Y 11 109392392 (GRCm38) V186A T C missense Het probably benign 0.000 phenotype 2019-12-04
18 603876 UTSW Grk3 0.000 RF021 G1 225.01 Y 5 112941688 (GRCm38) I333L T A missense Het probably benign 0.201 phenotype 2019-12-04
19 603909 UTSW Gstp1 0.402 RF021 G1 225.01 N 19 4035507 (GRCm38) V200E A T missense Het probably benign 0.006 phenotype 2019-12-04
20 603882 UTSW Gtf2h1 0.969 RF021 G1 225.01 Y 7 46803865 (GRCm38) V74G T G missense Het possibly damaging 0.877 2019-12-04
21 603908 UTSW Kcnh8 0.000 RF021 G1 225.01 Y 17 52978239 (GRCm38) R1079H G A missense Het probably benign 0.004 phenotype 2019-12-04
22 603863 UTSW Kiz 0.000 RF021 G1 225.01 Y 2 146870830 (GRCm38) D138G A G missense Het possibly damaging 0.742 phenotype 2019-12-04
23 603881 UTSW Kmt2b 1.000 RF021 G1 217.47 N 7 30586357 (GRCm38) TTCTCCT TTCTCCTTCTCCT unclassified Het probably benign phenotype 2019-12-04
24 603890 UTSW Lats1 0.835 RF021 G1 225.01 Y 10 7710608 (GRCm38) T912A A G missense Het probably damaging 1.000 phenotype 2019-12-04
25 603869 UTSW Lce1m RF021 G1 217.47 N 3 93018269 (GRCm38) GCTGCCACC GCTGCCACCACTTCTGCCACC unclassified Het probably benign 2019-12-04
26 603870 UTSW Lce1m RF021 G1 187.47 N 3 93018295 (GRCm38) TGCC TGCCGCCGCTGCCGCC unclassified Het probably benign 2019-12-04
27 603889 UTSW Lrrc2 0.000 RF021 G1 214.46 Y 9 110981676 (GRCm38) TTGATTCGGTTCACC T makesense Het probably null phenotype 2019-12-04
28 603868 UTSW Med12l 0.271 RF021 G1 225.01 Y 3 59073290 (GRCm38) F359S T C missense Het probably benign 0.191 phenotype 2019-12-04
29 603907 UTSW Mut 1.000 RF021 G1 225.01 Y 17 40951758 (GRCm38) I444V A G missense Het probably benign 0.009 phenotype 2019-12-04
30 603854 UTSW Ncoa2 0.959 RF021 G1 118.47 Y 1 13149109 (GRCm38) CTTAAAA C critical splice acceptor site Het probably benign phenotype 2019-12-04
31 603888 UTSW Ngp 0.000 RF021 G1 225.01 Y 9 110421756 (GRCm38) T114A A G missense Het possibly damaging 0.545 2019-12-04
32 603883 UTSW Nlrc5 0.000 RF021 G1 225.01 Y 8 94476888 (GRCm38) T539S A T missense Het probably benign 0.161 phenotype 2019-12-04
33 603911 UTSW Nxf1 1.000 RF021 G1 225.01 N 19 8772309 (GRCm38) D190G A G missense Het probably damaging 1.000 phenotype 2019-12-04
34 603886 UTSW Olfr229 0.078 RF021 G1 225.01 Y 9 39910045 (GRCm38) M81L A T missense Het probably benign 0.002 0.090 phenotype 2019-12-04
35 603892 UTSW Olfr769 0.068 RF021 G1 225.01 Y 10 129112342 (GRCm38) F28I A T missense Het probably damaging 0.987 phenotype 2019-12-04
36 603875 UTSW Pramef25 0.060 RF021 G1 225.01 Y 4 143948908 (GRCm38) Q449H C G missense Het probably damaging 0.963 2019-12-04
37 603905 UTSW Prdm15 0.000 RF021 G1 225.01 Y 16 97808756 (GRCm38) H563Y G A missense Het probably damaging 1.000 2019-12-04
38 603866 UTSW Rbm12 0.872 RF021 G1 214.59 N 2 156096106 (GRCm38) CAGG CAGGGATTGCGGGACCTGGTATTGCGGGACCAGG intron Het probably benign phenotype 2019-12-04
39 603897 UTSW Sema3g 0.000 RF021 G1 225.01 Y 14 31227841 (GRCm38) H660Y C T missense Het probably damaging 1.000 phenotype 2019-12-04
40 603912 UTSW Smarca2 0.000 RF021 G1 214.46 N 19 26630997 (GRCm38) AGCAGCAGCAGCAGCAGCAGCA AGCAGCAGCAGCAGCAGCAGCAGCAGCA unclassified Het probably benign phenotype 2019-12-04
41 603871 UTSW Stpg2 0.058 RF021 G1 113.01 Y 3 139212250 (GRCm38) A T critical splice acceptor site Het probably null 0.948 2019-12-04
42 603891 UTSW Taar7f 0.085 RF021 G1 225.01 Y 10 24050423 (GRCm38) T305M C T missense Het possibly damaging 0.889 2019-12-04
43 603880 UTSW Tbcb 0.958 RF021 G1 225.01 Y 7 30224346 (GRCm38) V208M C T missense Het probably damaging 1.000 2019-12-04
44 603894 UTSW Tenm2 0.448 RF021 G1 225.01 Y 11 36024203 (GRCm38) Q2169L T A missense Het possibly damaging 0.951 phenotype 2019-12-04
45 603872 UTSW Tln1 1.000 RF021 G1 225.01 Y 4 43555890 (GRCm38) V108A A G missense Het probably damaging 1.000 phenotype 2019-12-04
46 603896 UTSW Tmc8 0.050 RF021 G1 191.01 Y 11 117783234 (GRCm38) M42T T C missense Het probably benign 0.003 phenotype 2019-12-04
47 603899 UTSW Trdc 0.087 RF021 G1 225.01 Y 14 54144203 (GRCm38) V115A T C missense Het phenotype 2019-12-04
48 603861 UTSW Ttbk2 1.000 RF021 G1 225.01 Y 2 120748634 (GRCm38) V669A A G missense Het probably benign 0.000 phenotype 2019-12-04
49 603873 UTSW Tusc1 0.000 RF021 G1 207.59 N 4 93335316 (GRCm38) GCC GCCACCACC small insertion Het probably benign phenotype 2019-12-04
50 603862 UTSW Vps16 0.969 RF021 G1 225.01 Y 2 130438209 (GRCm38) H118R A G missense Het probably benign 0.090 phenotype 2019-12-04
51 603893 UTSW Wdpcp 0.895 RF021 G1 225.01 Y 11 21711587 (GRCm38) C286* T A nonsense Het probably null phenotype 2019-12-04
52 603901 UTSW Zbed4 0.580 RF021 G1 225.01 N 15 88781236 (GRCm38) Y502* C A nonsense Het probably null 2019-12-04
53 603856 UTSW Zdbf2 0.108 RF021 G1 225.01 Y 1 63302652 (GRCm38) N63K T A missense Het possibly damaging 0.816 phenotype 2019-12-04
[records 1 to 53 of 53]