Incidental Mutations

29 incidental mutations are currently displayed, and affect 28 genes.
2 are Possibly Damaging.
0 are Probably Damaging.
20 are Probably Benign.
7 are Probably Null.
0 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 29 of 29] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 604181 UTSW 4930402H24Rik 0.000 RF027 G1 191.47 N 2 130770744 CTC CTCGTC small insertion Het probably benign phenotype 12/04/2019
2 604192 UTSW Blm 1.000 RF027 G1 217.47 N 7 80512914 CCTCCTCCTCCTC CCTCCTCCTCCTCTCCTCCTCCTC frame shift Het probably null phenotype 12/04/2019
3 604206 UTSW Cacna1f 0.000 RF027 G1 120.47 N X 7620054 GAG GAGTAG nonsense Het probably null phenotype 12/04/2019
4 604196 UTSW Ccdc170 0.241 RF027 G1 192.6 N 10 4561026 ACC ACCTCC small insertion Het probably benign phenotype 12/04/2019
5 604202 UTSW Cul9 0.352 RF027 G1 200.47 N 17 46500848 CTTC CTTCTTC small insertion Het probably benign phenotype 12/04/2019
6 604195 UTSW Cyb5r4 0.000 RF027 G1 217.47 N 9 87040431 AGACACACTGCCCAGG AGACACACTGCCCAGGTATGTGACCGACACACTGCCCAGG small insertion Het probably benign phenotype 12/04/2019
7 604190 UTSW Dmkn 0.094 RF027 G1 217.47 N 7 30767194 GTGGA GTGGACGTGGTGGAAGTGGTGGAAGTGTTGGA small insertion Het probably benign phenotype 12/04/2019
8 604201 UTSW Dnah8 0.312 RF027 G1 214.46 N 17 30635476 CCCTCCCG C frame shift Het probably null phenotype 12/04/2019
9 604180 UTSW Fam171b 0.076 RF027 G1 217.47 N 2 83812876 AGCAGC AGCAGCTGCAGC small insertion Het probably benign 12/04/2019
10 604200 UTSW Flywch1 1.000 RF027 G1 214.46 N 17 23762158 TCACTCACCCACTCCTGGTGT TCACTCACCCACTCCTGGTGTGGGGAGGCTACGCACTCACCCACTCCTGGTGT frame shift Het probably null 12/04/2019
11 604179 UTSW Ifi208 0.000 RF027 G1 169.46 N 1 173677696 AGATG AG small deletion Het probably benign 12/04/2019
12 604194 UTSW Kri1 1.000 RF027 G1 138.47 N 9 21281068 CTCCTCCT C frame shift Het probably null phenotype 12/04/2019
13 604178 UTSW Krtap28-10 RF027 G1 217.6 N 1 83042285 CACAGC CACAGCCACAGCCACAACAGC unclassified Het probably benign 12/04/2019
14 604185 UTSW Lor 0.102 RF027 G1 129.47 N 3 92081876 ATAGCCG A small deletion Het probably benign phenotype 12/04/2019
15 604189 UTSW Lrmp 0.000 RF027 G1 214.48 N 6 145173790 TG TGAGCACATGG unclassified Het probably benign phenotype 12/04/2019
16 604182 UTSW Med12l 0.370 RF027 G1 194.47 N 3 59275967 AGC AGCGGC small insertion Het probably benign phenotype 12/04/2019
17 604183 UTSW Med12l 0.370 RF027 G1 217.47 N 3 59275981 CAG CAGAAG small insertion Het probably benign phenotype 12/04/2019
18 604187 UTSW Mn1 1.000 RF027 G1 181.47 N 5 111419705 CAG CAGAAG small insertion Het probably benign phenotype 12/04/2019
19 604184 UTSW Mnd1 0.000 RF027 G1 225.01 N 3 84134059 L79F G A missense Het possibly damaging 0.948 phenotype 12/04/2019
20 604204 UTSW Nolc1 0.000 RF027 G1 217.47 N 19 46081363 AGCAGCAGC AGCAGCAGCGGCAGCAGC small insertion Het probably benign 12/04/2019
21 604198 UTSW Papd7 0.256 RF027 G1 170.46 N 13 69533854 GACA G unclassified Het probably benign phenotype 12/04/2019
22 604205 UTSW Pdcd11 0.966 RF027 G1 217.47 N 19 47113449 GGAGGAG GG frame shift Het probably null phenotype 12/04/2019
23 604199 UTSW Rbfox2 0.543 RF027 G1 213.01 N 15 77132773 Q134K G T missense Het possibly damaging 0.942 phenotype 12/04/2019
24 604203 UTSW Tcof1 1.000 RF027 G1 175.47 N 18 60835736 AGC AGCTGC unclassified Het probably benign phenotype 12/04/2019
25 604186 UTSW Ttf2 0.958 RF027 G1 214.46 N 3 100963157 TTCT TTCTTCT small insertion Het probably benign phenotype 12/04/2019
26 604197 UTSW Ubtf 1.000 RF027 G1 197.63 N 11 102306945 CTTC CTTCTTC small insertion Het probably benign phenotype 12/04/2019
27 604191 UTSW Vmn2r58 0.315 RF027 G1 214.46 N 7 41836959 CAAAATGATGTAGCACTT C frame shift Het probably null 12/04/2019
28 604193 UTSW Zfhx3 0.941 RF027 G1 217.49 N 8 108956098 CAGCAGCA CAGCAGCAAGAGCAGCA small insertion Het probably benign phenotype 12/04/2019
29 604188 UTSW Zfp384 0.243 RF027 G1 217.47 N 6 125036490 CCCAGGC CCCAGGCCCAGGACCAGGC unclassified Het probably benign phenotype 12/04/2019
[records 1 to 29 of 29]