Incidental Mutations

48 incidental mutations are currently displayed, and affect 43 genes.
0 are Possibly Damaging.
0 are Probably Damaging.
34 are Probably Benign.
14 are Probably Null.
0 create premature stop codons.
4 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 48 of 48] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 604207 UTSW A030005L19Rik RF028 G1 217.48 N 1 82913578 GCTGTG GCTGTGCCTCCTGTG small insertion Het probably benign 12/04/2019
2 604208 UTSW A030005L19Rik RF028 G1 215.92 N 1 82913580 TGTGGCTGC TGTGGCTGCCGTGGCTGC small insertion Het probably benign 12/04/2019
3 604225 UTSW Acap3 0.146 RF028 G1 217.47 N 4 155905091 TGCATCCTGGGCTGC TGCATCCTGGGCTGCAGCATCCTGGGCTGC small insertion Het probably benign 12/04/2019
4 604246 UTSW Arid1b 0.651 RF028 G1 181.47 N 17 4995598 C CGGG small insertion Het probably benign phenotype 12/04/2019
5 604231 UTSW Blm 1.000 RF028 G1 217.47 N 7 80512905 CCTCCTCCTCCTCCTCCTCCTCCT CCTCCTCCTCCTACTCCTCCTCCTCCTCCTCCTCCT nonsense Het probably null phenotype 12/04/2019
6 604245 UTSW Boc 0.000 RF028 G1 102.46 N 16 44496433 GAC G frame shift Het probably null phenotype 12/04/2019
7 604250 UTSW Cacna1f 0.000 RF028 G1 146.47 N X 7620060 GAG GAGAAG utr 3 prime Het probably benign phenotype 12/04/2019
8 604251 UTSW Cacna1f 0.000 RF028 G1 149.47 N X 7620063 GAG GAGAAG utr 3 prime Het probably benign phenotype 12/04/2019
9 604216 UTSW Catsper2 0.099 RF028 G1 214.46 N 2 121397726 ATCGCTTTCCTCGTTTTCG ATCG utr 3 prime Het probably benign phenotype 12/04/2019
10 604235 UTSW Dbr1 1.000 RF028 G1 217.47 N 9 99583697 GAGGAG GAGGAGTAGGAG nonsense Het probably null phenotype 12/04/2019
11 604247 UTSW E4f1 1.000 RF028 G1 206.46 N 17 24455190 CGC CGCGGC unclassified Het probably benign phenotype 12/04/2019
12 604230 UTSW Eps8 0.419 RF028 G1 188.46 N 6 137517063 TCGCTC TCGCTCGCTC critical splice donor site Het probably benign phenotype 12/04/2019
13 604210 UTSW Ermn 0.000 RF028 G1 196.47 N 2 58048066 AACT AACTACT unclassified Het probably benign 12/04/2019
14 604212 UTSW Fsip2 0.108 RF028 G1 217.47 N 2 82994008 TAGATGTGAAACCCTTAGAGGTAAGATGTGAAACTCTTAGAGGTAAGA TAGATGTGAAACTCTTAGAGGTAAGA frame shift Het probably null phenotype 12/04/2019
15 604253 UTSW Gab3 0.000 RF028 G1 129.47 N X 75000000 CTTCTT CTTATTCTT nonsense Het probably null phenotype 12/04/2019
16 604254 UTSW Gab3 0.000 RF028 G1 151.47 N X 75000017 TCT TCTGCT small insertion Het probably benign phenotype 12/04/2019
17 604252 UTSW Gabre RF028 G1 214.46 N X 72270763 CTC CTCTGGGTC small insertion Het probably benign 12/04/2019
18 604232 UTSW Gm7579 0.253 RF028 G1 177.47 N 7 142212045 GGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGATGCAAGGGAGGCTGTGGCTCCTGTGGGGG GGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGATGCAAGGGAGGCTGTGGCTCCTGTGGGGG small deletion Het probably benign 12/04/2019
19 604249 UTSW Gm8369 0.060 RF028 G1 151.47 N 19 11511773 TG TGGGTGAG nonsense Het probably null 12/04/2019
20 604221 UTSW Hsdl2 0.000 RF028 G1 217.47 N 4 59610650 CAGCTGCAG CAGCTGCAGCAGCAGCCATAGCTGCAG nonsense Het probably null 12/04/2019
21 604236 UTSW Iqcf4 0.063 RF028 G1 161.47 N 9 106570614 TTTTCCTTTT TTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCGTTTCCTTTT small insertion Het probably benign 12/04/2019
22 604226 UTSW Kmt2e 1.000 RF028 G1 129.47 N 5 23478509 TTT TTTTATT critical splice acceptor site Het probably benign phenotype 12/04/2019
23 604234 UTSW Kri1 1.000 RF028 G1 217.47 N 9 21281071 CTCCTCCT C frame shift Het probably null phenotype 12/04/2019
24 604209 UTSW Krtap28-10 RF028 G1 203.47 N 1 83042258 AGCCACAGCCACCACAGCCACAGCCACCAC AGCCACAGCCACCACCGCCACAGCCACCACAGCCACAGCCACCAC unclassified Het probably benign 12/04/2019
25 604220 UTSW Lce1m RF028 G1 217.47 N 3 93018131 GTTGCTGCCACTG GTTGCTGCCACTGTTGCTGCCACTG unclassified Het probably benign 12/04/2019
26 604219 UTSW Lor 0.089 RF028 G1 217.47 N 3 92081899 CGCCGCCT C frame shift Het probably null phenotype 12/04/2019
27 604223 UTSW Luzp1 0.871 RF028 G1 214.46 N 4 136543196 A AGGTGGCCTCTTCAGG small insertion Het probably benign phenotype 12/04/2019
28 604240 UTSW Lypd8 0.066 RF028 G1 217.47 N 11 58390239 CCAACA CCAACAGGTCCCTCGCCTCTGTTACCCCACAAATAAACAACA small insertion Het probably benign phenotype 12/04/2019
29 604228 UTSW Mn1 1.000 RF028 G1 206.5 N 5 111419711 CAG CAGGAG small insertion Het probably benign phenotype 12/04/2019
30 604238 UTSW Nefh 0.000 RF028 G1 217.47 N 11 4941012 GGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC GGGACTTGGCCTCACCTGTGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC small insertion Het probably benign phenotype 12/04/2019
31 604239 UTSW Nefh 0.000 RF028 G1 217.47 N 11 4941029 GGGGACTTGGCCTCACCTGGGGACTTGGCCTC GGGGACTTGGCCTCACCTTGGGACTTGGCCTCACCTGGGGACTTGGCCTC small insertion Het probably benign phenotype 12/04/2019
32 604237 UTSW Nf2 1.000 RF028 G1 214.46 N 11 4829936 AAAAG A frame shift Het probably null phenotype 12/04/2019
33 604214 UTSW Nusap1 1.000 RF028 G1 152.47 N 2 119627578 AGAT AGATCCACGTTAGCAGTGAGGAGCAAGCTGCGAT small insertion Het probably benign phenotype 12/04/2019
34 604215 UTSW Nusap1 1.000 RF028 G1 193.47 N 2 119627591 CAGTGAGGAGCAAGCTGAGA CAGTGAGGAGCAAGCTGAGATACACGTTAGTAGTGAGGAGCAAGCTGAGA small insertion Het probably benign phenotype 12/04/2019
35 604218 UTSW Phf20 0.898 RF028 G1 108.47 N 2 156304623 CCCCCC CCCCCCGCCCCC critical splice acceptor site Het probably benign phenotype 12/04/2019
36 604222 UTSW Ppp1r8 1.000 RF028 G1 156.47 N 4 132830615 TCTCTCTCAC TC critical splice donor site Het probably benign phenotype 12/04/2019
37 604213 UTSW Prr5l 0.217 RF028 G1 214.46 N 2 101797573 GCCTC G frame shift Het probably null 12/04/2019
38 604217 UTSW Rbm12 0.911 RF028 G1 130.47 N 2 156096130 CGGGACCGGGCATTGCGGGACCGGGCATTGCGGG CGG frame shift Het probably null phenotype 12/04/2019
39 604242 UTSW Rpgrip1 0.214 RF028 G1 181.25 N 14 52149398 GA GAGTA nonsense Het probably null phenotype 12/04/2019
40 604211 UTSW Tanc1 0.000 RF028 G1 214.46 N 2 59843269 GTGAGCAGAAACCAGCATTTAGAGGGAACCGGTCCCTTCACTGCAGGAA G small deletion Het probably benign phenotype 12/04/2019
41 604248 UTSW Tfeb 1.000 RF028 G1 133.48 N 17 47786097 GCA GCATCA small insertion Het probably benign phenotype 12/04/2019
42 604229 UTSW Tgoln1 0.142 RF028 G1 217.47 N 6 72616036 T TTGTCTTGTCAGAATCACCTCCTGG small insertion Het probably benign 12/04/2019
43 604227 UTSW Thegl 0.061 RF028 G1 217.47 N 5 77016401 AGCGATCCTCCCCAGTCCCGCAAGGCC AGCGATCCTCCCCAGTCCCGCAAGGCCCGCGATCCTCCCCAGTCCCGCAAGGCC small insertion Het probably benign 12/04/2019
44 604241 UTSW Tob1 0.000 RF028 G1 206.47 N 11 94214451 CACA CACAACA small insertion Het probably benign phenotype 12/04/2019
45 604243 UTSW Trappc9 0.000 RF028 G1 217.47 N 15 72801290 GCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT GCTGCTGCTGCTGCTACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT small insertion Het probably benign phenotype 12/04/2019
46 604244 UTSW Triobp 1.000 RF028 G1 217.47 N 15 78967039 CAGGACT CAGGACTGCCTGTGCCCAACGGAACAACCCAAGGACT small insertion Het probably benign phenotype 12/04/2019
47 604233 UTSW Zfhx3 0.934 RF028 G1 217.47 N 8 108956096 AACAGCAGC AACAGCAGCTACAGCAGC small insertion Het probably benign phenotype 12/04/2019
48 604224 UTSW Zfp933 0.067 RF028 G1 217.48 N 4 147825731 TT TTTGCCT frame shift Het probably null 12/04/2019
[records 1 to 48 of 48]