Incidental Mutations

37 incidental mutations are currently displayed, and affect 33 genes.
0 are Possibly Damaging.
0 are Probably Damaging.
30 are Probably Benign.
7 are Probably Null.
0 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 37 of 37] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 604271 UTSW 5430401F13Rik 0.063 RF029 G1 148.47 N 6 131552895 GGTGGCCAG GGTGGCCAGCAAAAACAGAAAGGAAAAAGTGGCCAG small insertion Het probably benign 12/04/2019
2 604286 UTSW Abca17 0.000 RF029 G1 214.47 N 17 24287727 T TCCCTC critical splice donor site Het probably benign 12/04/2019
3 604291 UTSW Amot 0.234 RF029 G1 217.98 N X 145450988 GGAGCAGCAA G unclassified Het probably benign phenotype 12/04/2019
4 604270 UTSW C1s1 0.149 RF029 G1 214.46 N 6 124541351 CCCATGGCTC CC start codon destroyed Het probably null 12/04/2019
5 604275 UTSW Cacna1a 0.930 RF029 G1 201.47 N 8 84638724 CCA CCAACA small insertion Het probably benign phenotype 12/04/2019
6 604282 UTSW Ccdc170 0.294 RF029 G1 154.47 N 10 4561026 ACC ACCGCC small insertion Het probably benign phenotype 12/04/2019
7 604279 UTSW Cyb5r4 0.000 RF029 G1 217.47 N 9 87040430 CAGA CAGAGACACTGACCAGGGATGTGATAGA small insertion Het probably benign phenotype 12/04/2019
8 604280 UTSW Cyb5r4 0.000 RF029 G1 217.47 N 9 87040442 CCAGGGA CCAGGGATGTGACAGACACACTGCACAGGGA small insertion Het probably benign phenotype 12/04/2019
9 604262 UTSW Defb22 0.000 RF029 G1 214.46 N 2 152485833 GCGGCA GCGGCAGAGCTGGCCTTTGCGGCA small insertion Het probably benign 12/04/2019
10 604278 UTSW Dnmt1 1.000 RF029 G1 217.47 N 9 20910123 CGGAGCACAGTTCCTACCTCGTT CGGAGCACAGTTCCTACCTCGTTTTGGGGGAGGAGCACAGTTCCTACCTCGTT nonsense Het probably null phenotype 12/04/2019
11 604274 UTSW Eed 0.965 RF029 G1 225.01 N 7 89955032 A411S C A missense Het probably benign 0.000 phenotype 12/04/2019
12 604284 UTSW Exd2 0.109 RF029 G1 217.47 N 12 80475946 CCACAGC CC frame shift Het probably null 12/04/2019
13 604259 UTSW Fam171b 0.098 RF029 G1 214.47 N 2 83812892 GCAGC GCAGCATCAGC small insertion Het probably benign 12/04/2019
14 604268 UTSW Fbrsl1 0.072 RF029 G1 217.47 N 5 110378139 GCGTGTGCTGGT GCGTGTGCTGGTTCGTGTGCTGGT small insertion Het probably benign 12/04/2019
15 604258 UTSW Fsip2 0.120 RF029 G1 217.47 N 2 82994008 TAGATGTGAAACCCTTAGAGGTAAGATGTGAAACTCTTAGAGGTAAGA TAGATGTGAAACTCTTAGAGGTAAGA frame shift Het probably null phenotype 12/04/2019
16 604290 UTSW Gabre RF029 G1 214.46 N X 72270059 GGCTC GGCTCCTGCTC small insertion Het probably benign 12/04/2019
17 604255 UTSW Gm47955 RF029 G1 120.59 N 1 82960527 G GTTGTGGCTT small insertion Het probably benign 12/04/2019
18 604267 UTSW Gm572 0.083 RF029 G1 217.48 N 4 148671393 TGGGGGGGGGGGG TGGGGG frame shift Het probably null phenotype 12/04/2019
19 604283 UTSW Hic1 0.404 RF029 G1 116.47 N 11 75169442 CGGGGGGGGGG CGGGGGGG small deletion Het probably benign phenotype 12/04/2019
20 604257 UTSW Ifi208 0.000 RF029 G1 212.46 N 1 173677696 AGATG AG small deletion Het probably benign 12/04/2019
21 604266 UTSW Il2 RF029 G1 217.47 N 3 37125827 GTGG GTGGGGCTTGAACTGG unclassified Het probably benign phenotype 12/04/2019
22 604256 UTSW Krtap28-10 RF029 G1 143.47 N 1 83042270 CACAGCCACAGCCAC CACAGCCACAGCCACAACAGCCACAGCCAC unclassified Het probably benign 12/04/2019
23 604264 UTSW Lkaaear1 0.046 RF029 G1 217.47 N 2 181697579 GCTCCAGCTCCAGCTCCAGCTCCA GCTCCAGCTCCACCTCCAGCTCCAGCTCCAGCTCCA unclassified Het probably benign 12/04/2019
24 604265 UTSW Lkaaear1 0.046 RF029 G1 217.47 N 2 181697588 CCAGCTCCAGCT CCAGCTCCAGCTACAGCTCCAGCT unclassified Het probably benign 12/04/2019
25 604272 UTSW Lrmp 0.000 RF029 G1 214.46 N 6 145173790 TG TGAGCACATGG unclassified Het probably benign phenotype 12/04/2019
26 604260 UTSW Nusap1 1.000 RF029 G1 190.47 N 2 119627594 TGAGGAGCAAGCTGAGA TGAGGAGCAAGCTGAGATACACGTTAGCTGGGAGGAGCAAGCTGAGA small insertion Het probably benign phenotype 12/04/2019
27 604261 UTSW Nusap1 1.000 RF029 G1 190.47 N 2 119627605 CTGAGA CTGAGATACACGTTAGCAGTGAGGAGCAAGATGAGA small insertion Het probably benign phenotype 12/04/2019
28 604277 UTSW Pkd1l3 0.000 RF029 G1 214.46 N 8 109624195 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA small deletion Het probably benign 0.085 phenotype 12/04/2019
29 604273 UTSW Pnmal1 0.101 RF029 G1 217.5 N 7 16961444 CAACATC CAACATCTCATGATGCACCTGCTTAAACATC nonsense Het probably null 12/04/2019
30 604281 UTSW Rasa2 0.173 RF029 G1 132.47 N 9 96631467 CGC CGCAGC small insertion Het probably benign phenotype 12/04/2019
31 604263 UTSW Rbm12 0.906 RF029 G1 207.47 N 2 156096095 TATTGCGGGACCAGGTATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCAGGCATTGCGGGACC TATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCAGGCATTGCGGGACC intron Het probably benign phenotype 12/04/2019
32 604269 UTSW Reep1 0.000 RF029 G1 217.47 N 6 71707966 CGCCA CGCCAGCCA start codon destroyed Het probably null phenotype 12/04/2019
33 604288 UTSW Tcof1 1.000 RF029 G1 165.47 N 18 60835735 CAG CAGAAG unclassified Het probably benign phenotype 12/04/2019
34 604289 UTSW Tcof1 1.000 RF029 G1 189.47 N 18 60835745 AGC AGCGGC unclassified Het probably benign phenotype 12/04/2019
35 604285 UTSW Trappc9 0.000 RF029 G1 165.59 N 15 72801323 GCTGCTGCT GCTGCTGCTGCTGCTTCTGCTGCT small insertion Het probably benign phenotype 12/04/2019
36 604276 UTSW Zfhx3 0.925 RF029 G1 217.48 N 8 108956092 CAGCAACAG CAGCAACAGAAGCAACAG small insertion Het probably benign phenotype 12/04/2019
37 604287 UTSW Znrd1as 0.156 RF029 G1 132.47 N 17 36965071 CG CCACCACCACCACCCCCCCCAGG small insertion Het probably benign 12/04/2019
[records 1 to 37 of 37]