Incidental Mutations

38 incidental mutations are currently displayed, and affect 35 genes.
0 are Possibly Damaging.
1 are Probably Damaging.
27 are Probably Benign.
10 are Probably Null.
0 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 38 of 38] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 604423 UTSW Abca17 0.000 RF032 G1 153.51 N 17 24287727 TACCT TACCTGACCT frame shift Het probably null 12/04/2019
2 604406 UTSW Acap3 0.090 RF032 G1 214.46 N 4 155905102 CTGCTG CTGCTGCATCCTGGGATGCTG small insertion Het probably benign 12/04/2019
3 604422 UTSW Arid1b 0.623 RF032 G1 182.59 N 17 4995588 GCG GCGTCG small insertion Het probably benign phenotype 12/04/2019
4 604415 UTSW Blm 1.000 RF032 G1 217.54 N 7 80512930 CTCC CTCCTCCTCCTCGTCC small insertion Het probably benign phenotype 12/04/2019
5 604427 UTSW Cacna1f 0.000 RF032 G1 184.47 N X 7620063 GAG GAGTAG nonsense Het probably null phenotype 12/04/2019
6 604426 UTSW Calhm1 0.000 RF032 G1 217.47 N 19 47141283 C CTGTGGCCGTGG frame shift Het probably null phenotype 12/04/2019
7 604420 UTSW Cluh 0.247 RF032 G1 218.66 N 11 74669515 CCCGAGCC CCCGAGCCCGAGCC small insertion Het probably benign phenotype 12/04/2019
8 604418 UTSW Cyb5r4 0.000 RF032 G1 217.47 N 9 87040413 ACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA ACTGCCCAGGGATGTGACAGACACGCTGCCCAGGGATGTGACAGACACACTGCCCAGGGA small insertion Het probably benign phenotype 12/04/2019
9 604413 UTSW Dmkn 0.066 RF032 G1 217.47 N 7 30767182 GT GTTGTGAAAGTGGTGGAAGTGGTGGAATT small insertion Het probably benign phenotype 12/04/2019
10 604405 UTSW Efhd2 0.140 RF032 G1 216.26 N 4 141874772 CGCC CGCCGCAGCC small insertion Het probably benign phenotype 12/04/2019
11 604394 UTSW Enah 0.830 RF032 G1 217.47 N 1 181921929 TGGCGGTGG TG frame shift Het probably null phenotype 12/04/2019
12 604425 UTSW Gm8369 0.068 RF032 G1 217.47 N 19 11511778 GTGTGT GTGTGTATGTGT small insertion Het probably benign 12/04/2019
13 604424 UTSW H2-T10 0.084 RF032 G1 214.46 N 17 36120294 TTTCCCACTGTA T frame shift Het probably null 12/04/2019
14 604393 UTSW Ifi207 0.071 RF032 G1 214.46 N 1 173735157 GCCTGAGCTGTGGAAGTCTCCCCCTGAGCTGTGGAAGTCTC GCCTGAGCTGTGGAAGTCTC small deletion Het probably benign 12/04/2019
15 604414 UTSW Igf1r 1.000 RF032 G1 217 N 7 68226179 GATGGAGC GATGGAGCTGGATATGGAGC small insertion Het probably benign phenotype 12/04/2019
16 604391 UTSW Krtap28-10 RF032 G1 162.8 N 1 83042258 AGCCACAGCCACCACAGCCACAGCCACCAC AGCCACAGCCACCACCGCCACAGCCACCACAGCCACAGCCACCAC unclassified Het probably benign 12/04/2019
17 604395 UTSW Lmx1b 0.945 RF032 G1 217.47 N 2 33640489 TCCATCTTGATGCCGTCCAACATCTTGATGCCGTCCA TACATCTTGATGCCGTCCA nonsense Het probably null phenotype 12/04/2019
18 604399 UTSW Med12l 0.248 RF032 G1 174.47 N 3 59275981 CAG CAGAAG small insertion Het probably benign phenotype 12/04/2019
19 604400 UTSW Med12l 0.248 RF032 G1 182.47 N 3 59275985 AGC AGCGGC small insertion Het probably benign phenotype 12/04/2019
20 604401 UTSW Med12l 0.248 RF032 G1 178.47 N 3 59275989 GCA GCACCA small insertion Het probably benign phenotype 12/04/2019
21 604408 UTSW Mn1 1.000 RF032 G1 199.47 N 5 111419711 CAG CAGAAG small insertion Het probably benign phenotype 12/04/2019
22 604419 UTSW Nf2 1.000 RF032 G1 214.46 N 11 4829936 AAAAG A frame shift Het probably null phenotype 12/04/2019
23 604396 UTSW Nusap1 1.000 RF032 G1 217.47 N 2 119627587 TTAGCAGTGAGGAGCAAGCTGAGA TTAGCAGTGAGGAGCAAGCTGAGATACACGGTAGCAGTGAGGAGCAAGCTGAGA small insertion Het probably benign phenotype 12/04/2019
24 604392 UTSW Olfr418 0.107 RF032 G1 217.47 N 1 173270709 GTGACATC G frame shift Het probably null phenotype 12/04/2019
25 604404 UTSW Padi3 0.000 RF032 G1 197.54 N 4 140792972 TCTCAC TC critical splice donor site Het probably benign phenotype 12/04/2019
26 604412 UTSW Pik3c2g 0.114 RF032 G1 105.46 N 6 139635658 G GGAGA frame shift Het probably null phenotype 12/04/2019
27 604403 UTSW Pou3f1 1.000 RF032 G1 188.79 N 4 124657805 GGCGGCCG GGCGGCCGCGGCCG small insertion Het probably benign phenotype 12/04/2019
28 604407 UTSW Rassf6 0.098 RF032 G1 151.47 N 5 90608939 ATTC ATTCTGCCTCACTCATGGTCCTGTAGAGCAATGGGGCTTC utr 3 prime Het probably benign phenotype 12/04/2019
29 604409 UTSW Reep1 0.000 RF032 G1 193.47 N 6 71707968 CC CCCGAC start codon destroyed Het probably null phenotype 12/04/2019
30 604397 UTSW Slc12a1 0.213 RF032 G1 214.46 N 2 125154210 ACAAACC ACAAACCTTTGGCCACCAAACC small insertion Het probably benign phenotype 12/04/2019
31 604428 UTSW Smpx RF032 G1 209.46 N X 157720923 CCCCCCA C critical splice acceptor site Het probably benign phenotype 12/04/2019
32 604402 UTSW Spaca1 0.000 RF032 G1 217.47 N 4 34049854 TCGC TCGCTCACGC small insertion Het probably benign phenotype 12/04/2019
33 604398 UTSW Supt20 0.958 RF032 G1 217.47 N 3 54727666 GCAGCA GCAGCACCAGCA small insertion Het probably benign phenotype 12/04/2019
34 604410 UTSW Tgoln1 0.136 RF032 G1 217.47 N 6 72616063 GCTTGCCAGAAT GCTTGCCAGAATCACCTCCCGTGGTCTTGCCAGAAT small insertion Het probably benign 12/04/2019
35 604411 UTSW Tgoln1 0.136 RF032 G1 217.47 N 6 72616074 T TCACCTCCCGTGGGCTTGCCAGAAG small insertion Het probably benign 12/04/2019
36 604421 UTSW Triobp 1.000 RF032 G1 217.47 N 15 78967036 CCCCAGGACTCCCTGTGCCCAACGGGACAATCCCAGG CCCCAGGACTCCCTGTGCCCAACGGAACAATCCCAGGACTCCCTGTGCCCAACGGGACAATCCCAGG small insertion Het probably benign phenotype 12/04/2019
37 604417 UTSW Vat1l 0.096 RF032 G1 225.01 N 8 114289329 L320F C T missense Het probably damaging 1.000 12/04/2019
38 604416 UTSW Zfhx3 0.920 RF032 G1 214.46 N 8 108956092 CAGCAACAG CAGCAACAGAAGCAACAG small insertion Het probably benign phenotype 12/04/2019
[records 1 to 38 of 38]