Incidental Mutations

37 incidental mutations are currently displayed, and affect 32 genes.
1 are Possibly Damaging.
0 are Probably Damaging.
29 are Probably Benign.
7 are Probably Null.
0 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 37 of 37] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 604479 UTSW 4932438A13Rik 1.000 RF034 G1 217.47 N 3 37050760 T TTATTATGATTATTAC critical splice acceptor site Het probably benign phenotype 12/04/2019
2 604473 UTSW A030005L19Rik RF034 G1 217 N 1 82913580 TGTGGCTGC TGTGGCTGCGGTGGCTGC small insertion Het probably benign 12/04/2019
3 604483 UTSW Acap3 0.088 RF034 G1 217.8 N 4 155905092 GCATCCTGGGCTGCT GCATCCTGGGCTGCTACATCCTGGGCTGCT small insertion Het probably benign 12/04/2019
4 604490 UTSW Alpk3 0.533 RF034 G1 217.47 N 7 81092414 GAGAAGGCAC G small deletion Het probably benign phenotype 12/04/2019
5 604504 UTSW Cox7a2l 0.170 RF034 G1 214.46 N 17 83502722 GGA GGATGGGGA small insertion Het probably benign phenotype 12/04/2019
6 604478 UTSW Cpne1 0.696 RF034 G1 175.46 N 2 156073510 TCCAC TC intron Het probably benign phenotype 12/04/2019
7 604497 UTSW Cyb5r4 0.000 RF034 G1 217.47 N 9 87040417 CCCAGGGATGTGACAGACACACTG CCCAGGGATGTGACAGACACACTGACCAGGGATGTGACAGACACACTG small insertion Het probably benign phenotype 12/04/2019
8 604498 UTSW Cyb5r4 0.000 RF034 G1 217.47 N 9 87040447 GA GATGTGACAGACACACTGCCCAGGTA nonsense Het probably null phenotype 12/04/2019
9 604477 UTSW Defb22 0.000 RF034 G1 214.46 N 2 152485832 TGCGGCA TGCGGCAGGGCTGGCCTTTGCGGCA small insertion Het probably benign 12/04/2019
10 604496 UTSW Dnmt1 1.000 RF034 G1 217.51 N 9 20910120 GGGCGGAGCACAGTTCCTACCTCGTT GGGCGGAGCACAGTTCCTACCTCGTTTTGGTGGCGGAGCACAGTTCCTACCTCGTT nonsense Het probably null phenotype 12/04/2019
11 604488 UTSW Fam71e1 0.079 RF034 G1 217.47 N 7 44500523 GGGTCTGAGGGAGGA GGGTCTGAGGGAGGAAGGCTGGATCCTGGATACCTAGGTCTGAGGGAGGA frame shift Het probably null 12/04/2019
12 604487 UTSW Fbrsl1 0.076 RF034 G1 217.47 N 5 110378149 GTG GTGCGTGTGCTGTTG small insertion Het probably benign 12/04/2019
13 604492 UTSW Frem3 0.109 RF034 G1 214.46 N 8 80615238 GATC GATCATC small insertion Het probably benign phenotype 12/04/2019
14 604508 UTSW Gabre RF034 G1 214.49 N X 72270762 GCTC GCTCTGTCTC small insertion Het probably benign 12/04/2019
15 604509 UTSW Gm15155 RF034 G1 214.46 N X 156345640 CAA CAACAACAAA frame shift Het probably null 12/04/2019
16 604489 UTSW Igf1r 1.000 RF034 G1 214.46 N 7 68226176 GGAGATGGAGC GGAGATGGAGCTAGAGATGGAGC small insertion Het probably benign phenotype 12/04/2019
17 604474 UTSW Krtap28-10 RF034 G1 217.47 N 1 83042282 CACCACAGC CACCACAGCCACAGCGACCACAGC unclassified Het probably benign 12/04/2019
18 604507 UTSW Mamld1 RF034 G1 191.47 N X 71118835 AGC AGCGGC small insertion Het probably benign phenotype 12/04/2019
19 604475 UTSW Map1a 0.299 RF034 G1 217.47 N 2 121306304 CCAGCTCCAGCTCCA CCAGCTCCAGCTCCAGCTACAGCTCCAGATACAGCTCCAGCTCCA small insertion Het probably benign phenotype 12/04/2019
20 604476 UTSW Map1a 0.299 RF034 G1 217.47 N 2 121306307 GCTCCAGCTCCA GCTCCAGCTCCAGCTCCAGCTCCAGCTCCATCTCCAGCTCCA small insertion Het probably benign phenotype 12/04/2019
21 604501 UTSW Neu1 1.000 RF034 G1 214.46 N 17 34932558 TCTTCTA T unclassified Het probably benign phenotype 12/04/2019
22 604506 UTSW Nolc1 0.000 RF034 G1 217.47 N 19 46081371 CAGCAGC CAGCAGCAGAAGCAGC small insertion Het probably benign 12/04/2019
23 604495 UTSW Olfr850 0.165 RF034 G1 225.01 N 9 19477632 A206E G T missense Het possibly damaging 0.460 phenotype 12/04/2019
24 604482 UTSW Pdik1l 0.000 RF034 G1 214.59 N 4 134279374 TTTT TTTTGTTTTTGGTTT frame shift Het probably null 12/04/2019
25 604484 UTSW Rassf6 0.066 RF034 G1 217.47 N 5 90608912 CACTCATGGTCCTGTAGAGCAATGGGGATTC CACTCATGGTCCTGTAGAGCAATGGGGATTCTGCCTGACTCATGGTCCTGTAGAGCAATGGGGATTC utr 3 prime Het probably benign phenotype 12/04/2019
26 604485 UTSW Rassf6 0.066 RF034 G1 217.47 N 5 90608917 ATGGTCCTGTAGAGCAATGGGGATTC ATGGTCCTGTAGAGCAATGGGGATTCTGCCTCACTCGTGGTCCTGTAGAGCAATGGGGATTC utr 3 prime Het probably benign phenotype 12/04/2019
27 604486 UTSW Rassf6 0.066 RF034 G1 217.47 N 5 90608923 CTGTAGAGCAATGGGGATTC CTGTAGAGCAATGGGGATTCTGCCTCACTCATGGTCATGTAGAGCAATGGGGATTC utr 3 prime Het probably benign phenotype 12/04/2019
28 604499 UTSW Rpgrip1 0.286 RF034 G1 214.46 N 14 52149526 AGAGGAGGA AGA utr 3 prime Het probably benign phenotype 12/04/2019
29 604480 UTSW Rprd2 0.745 RF034 G1 214.46 N 3 95766320 AGAGCCTGTGGTGCTCGCAGGGGAGGCTGTGGTGCTC AGAGGCTGTGGTGCTC small deletion Het probably benign 12/04/2019
30 604491 UTSW Rsf1 1.000 RF034 G1 214.46 N 7 97579908 CG CGAGG unclassified Het probably benign phenotype 12/04/2019
31 604493 UTSW Rtbdn 0.000 RF034 G1 217.47 N 8 84956175 GCGGC GCGGCATCGGC small insertion Het probably benign phenotype 12/04/2019
32 604505 UTSW Smarca2 0.000 RF034 G1 170.87 N 19 26631011 CA CACCAAGA unclassified Het probably benign phenotype 12/04/2019
33 604502 UTSW Tfeb 1.000 RF034 G1 146.47 N 17 47786097 GCA GCACCA small insertion Het probably benign phenotype 12/04/2019
34 604503 UTSW Tfeb 1.000 RF034 G1 153.47 N 17 47786098 CAG CAGTAG nonsense Het probably null phenotype 12/04/2019
35 604494 UTSW Tmed6 0.000 RF034 G1 214.46 N 8 107061596 AGC AGCTGGC frame shift Het probably null 12/04/2019
36 604481 UTSW Tomm5 0.089 RF034 G1 126.47 N 4 45107976 TCTTCCGC TCTTCCGCAGCTTCCGC small insertion Het probably benign phenotype 12/04/2019
37 604500 UTSW Trappc9 0.000 RF034 G1 201.47 N 15 72801298 TG TGATGCTGCTGCTGCGG small insertion Het probably benign phenotype 12/04/2019
[records 1 to 37 of 37]