Incidental Mutations

55 incidental mutations are currently displayed, and affect 48 genes.
0 are Possibly Damaging.
0 are Probably Damaging.
42 are Probably Benign.
13 are Probably Null.
0 create premature stop codons.
5 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 55 of 55] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 604771 UTSW 4930432K21Rik 0.075 RF040 G1 214.53 N 8 84167575 TG TGTCAGGGCAGCAGCAG small insertion Het probably benign 12/04/2019
2 604747 UTSW A030005L19Rik RF040 G1 217.52 N 1 82913577 TGCTGTG TGCTGTGACAGCTGTG small insertion Het probably benign 12/04/2019
3 604748 UTSW A030005L19Rik RF040 G1 214.87 N 1 82913590 G GTGGCTGCTC small insertion Het probably benign 12/04/2019
4 604798 UTSW Cacna1f 0.000 RF040 G1 217.47 N X 7618971 CTGAATTGGTTCCCAGACCCGTGT CT frame shift Het probably null phenotype 12/04/2019
5 604797 UTSW Calhm1 0.000 RF040 G1 217.47 N 19 47141277 C CTGTGGCTGTGGA unclassified Het probably benign phenotype 12/04/2019
6 604793 UTSW Cdx1 0.875 RF040 G1 217.47 N 18 61019870 CTGCTG CTGCTGATGCTG small insertion Het probably benign phenotype 12/04/2019
7 604774 UTSW Cyb5r4 0.000 RF040 G1 217.47 N 9 87040409 ACACACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA ACACACTGCCCAGGGATGTGACAGCCACACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA small insertion Het probably benign phenotype 12/04/2019
8 604775 UTSW Dbr1 1.000 RF040 G1 217.47 N 9 99583697 GAGGAG GAGGAGTAGGAG nonsense Het probably null phenotype 12/04/2019
9 604763 UTSW Dnajc2 0.955 RF040 G1 100.46 N 5 21757697 TAGTTG T makesense Het probably null phenotype 12/04/2019
10 604758 UTSW Fam205c 0.063 RF040 G1 147.47 N 4 42871823 TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG small deletion Het probably benign 0.090 12/04/2019
11 604767 UTSW Fam71e1 0.103 RF040 G1 217.47 N 7 44500521 C CGGGGTCAGAGGGAGGAAGGCTGGATCCTGGATACA frame shift Het probably null 12/04/2019
12 604768 UTSW Fam71e1 0.103 RF040 G1 217.47 N 7 44500531 GGGAGGA GGGAGGAAGGCTGGATCCTGGATACCTGGGTCTGATGGAGGA frame shift Het probably null 12/04/2019
13 604776 UTSW Fgd6 0.405 RF040 G1 155.46 N 10 94044325 ATT A frame shift Het probably null 12/04/2019
14 604785 UTSW Flywch1 1.000 RF040 G1 217.47 N 17 23762169 CTCCTGGTGT CTCCTGGTGTGGGGAGGCTACGTACTCACCCAGTCCTGGTGT frame shift Het probably null 12/04/2019
15 604800 UTSW Gab3 0.000 RF040 G1 180.47 N X 75000027 CTT CTTTTT small insertion Het probably benign phenotype 12/04/2019
16 604770 UTSW Gm40460 RF040 G1 191.46 N 7 142240817 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG small deletion Het probably benign 12/04/2019
17 604790 UTSW Gykl1 0.368 RF040 G1 225.01 N 18 52694416 R232Q G A missense Het probably benign 0.062 phenotype 12/04/2019
18 604772 UTSW Heatr3 0.923 RF040 G1 217.47 N 8 88156457 TAT TATTGAT critical splice acceptor site Het probably benign phenotype 12/04/2019
19 604764 UTSW Kmt2e 1.000 RF040 G1 184.47 N 5 23478509 TTT TTTTCTT critical splice acceptor site Het probably benign phenotype 12/04/2019
20 604761 UTSW Luzp1 0.871 RF040 G1 214.46 N 4 136543196 A AGGTGGCCTCTTCAGC small insertion Het probably benign phenotype 12/04/2019
21 604799 UTSW Mamld1 RF040 G1 174.47 N X 71118814 AACA AACAACA small insertion Het probably benign phenotype 12/04/2019
22 604779 UTSW Mast4 0.322 RF040 G1 217.55 N 13 102739241 CCTCGGGGACAAGCTGTGAGTTGGGGAAC CC small deletion Het probably benign phenotype 12/04/2019
23 604754 UTSW Med12l 0.408 RF040 G1 217.47 N 3 59275967 AGC AGCCGC small insertion Het probably benign phenotype 12/04/2019
24 604755 UTSW Med12l 0.408 RF040 G1 207.47 N 3 59275989 GCA GCATCA small insertion Het probably benign phenotype 12/04/2019
25 604765 UTSW Mn1 1.000 RF040 G1 199.47 N 5 111419705 CAG CAGAAG small insertion Het probably benign phenotype 12/04/2019
26 604795 UTSW Morn4 0.212 RF040 G1 214.46 N 19 42076111 GCAGTGAG GCAGTGAGTCAGTCAGTGAG nonsense Het probably null 12/04/2019
27 604753 UTSW Ncoa6 1.000 RF040 G1 120.47 N 2 155421731 TGCAGC TGC small deletion Het probably benign phenotype 12/04/2019
28 604778 UTSW Nlrp3 0.086 RF040 G1 213.58 N 11 59558552 GGGTA G frame shift Het probably null phenotype 12/04/2019
29 604796 UTSW Nolc1 0.000 RF040 G1 217.47 N 19 46081363 AGCAGCAGC AGCAGCAGCCGCAGCAGC small insertion Het probably benign 12/04/2019
30 604752 UTSW Nusap1 1.000 RF040 G1 217.47 N 2 119627587 TTAGCAGTGAGGAGCAAGCTGAGA TTAGCAGTGAGGAGCAAGCTGAGATACACGGTAGCAGTGAGGAGCAAGCTGAGA small insertion Het probably benign phenotype 12/04/2019
31 604749 UTSW Olfr418 0.106 RF040 G1 217.47 N 1 173270709 GTGACATC G frame shift Het probably null phenotype 12/04/2019
32 604769 UTSW Olfr625-ps1 0.078 RF040 G1 214.46 N 7 103682938 ACTTGCTGATATCTT ACTT frame shift Het probably null 12/04/2019
33 604781 UTSW Osmr 0.060 RF040 G1 214.46 N 15 6837701 TTCT TTCTTCT small insertion Het probably benign phenotype 12/04/2019
34 604762 UTSW Padi3 0.000 RF040 G1 214.46 N 4 140792972 TCTCAC TC critical splice donor site Het probably benign phenotype 12/04/2019
35 604760 UTSW Pdik1l 0.000 RF040 G1 214.46 N 4 134279515 AC ACCACCGC intron Het probably benign 12/04/2019
36 604780 UTSW Rpgrip1 0.214 RF040 G1 153.25 N 14 52149537 AGGAAGAGG AG frame shift Het probably null phenotype 12/04/2019
37 604757 UTSW Rragd 0.000 RF040 G1 214.46 N 4 32995150 CATGCCTTTCATTCTA C intron Het probably benign phenotype 12/04/2019
38 604751 UTSW Ryr3 0.514 RF040 G1 114.47 N 2 112910524 CTGA C critical splice acceptor site Het probably benign phenotype 12/04/2019
39 604777 UTSW Sh3pxd2b 0.406 RF040 G1 194.47 N 11 32423055 CCTGTG CCTGTGTCTGTG small insertion Het probably benign phenotype 12/04/2019
40 604783 UTSW Slc39a4 1.000 RF040 G1 217.47 N 15 76614866 TGTGGTC TGTGGTCATCATGATCACCATGGTCACCATGATCACGGTGGTC small insertion Het probably benign phenotype 12/04/2019
41 604794 UTSW Smarca2 0.000 RF040 G1 216.47 N 19 26631022 GC GCCCCACC unclassified Het probably benign phenotype 12/04/2019
42 604756 UTSW Sprr2b 0.078 RF040 G1 217.47 N 3 92317564 CAGTATGCTGTGAGCCTTGTCCTCCT C frame shift Het probably null 12/04/2019
43 604801 UTSW Sry 0.318 RF040 G1 146.72 N Y 2662590 GCTG GCTGGTGGTGGTGGTCATGGAACTG small insertion Het probably benign phenotype 12/04/2019
44 604791 UTSW Tcof1 1.000 RF040 G1 194.46 N 18 60828408 CT CTATT small insertion Het probably benign phenotype 12/04/2019
45 604792 UTSW Tcof1 1.000 RF040 G1 217.47 N 18 60833583 GC GCTGCTGAGATGGGCACTTTCCCAGAGATCCCCTTGTC small insertion Het probably benign phenotype 12/04/2019
46 604786 UTSW Tfeb 1.000 RF040 G1 166.47 N 17 47786097 GCA GCAACA small insertion Het probably benign phenotype 12/04/2019
47 604787 UTSW Tfeb 1.000 RF040 G1 173.47 N 17 47786110 CAG CAGGAG small insertion Het probably benign phenotype 12/04/2019
48 604788 UTSW Tfeb 1.000 RF040 G1 162.47 N 17 47786111 AGC AGCCGC small insertion Het probably benign phenotype 12/04/2019
49 604789 UTSW Tfeb 1.000 RF040 G1 194.47 N 17 47786112 GCA GCATCA small insertion Het probably benign phenotype 12/04/2019
50 604766 UTSW Tgoln1 0.142 RF040 G1 217.47 N 6 72616074 T TCACCTCCCGTGGTCTTGCCAGAAG small insertion Het probably benign 12/04/2019
51 604759 UTSW Tmem59 0.069 RF040 G1 217.47 N 4 107190526 TTTGTTT TTTGTTTGGTTGTTT critical splice acceptor site Het probably benign phenotype 12/04/2019
52 604782 UTSW Trappc9 0.000 RF040 G1 217.47 N 15 72801292 TGCTGCTGCTGCTGCTGCTGCTGCTGCTGC TGCTGCTGCTGCTGCGGCTGCTGCTGCTGCTGCTGCTGCTGCTGC small insertion Het probably benign phenotype 12/04/2019
53 604784 UTSW Triobp 1.000 RF040 G1 217.47 N 15 78967063 CAA CAACCCCAGGACTCCCTGTGCCCAACGGGGGAA small insertion Het probably benign phenotype 12/04/2019
54 604750 UTSW Xirp2 0.224 RF040 G1 214.46 N 2 67525544 TT TTTAT utr 3 prime Het probably benign phenotype 12/04/2019
55 604773 UTSW Zfhx3 0.934 RF040 G1 217.5 N 8 108956101 CAGCA CAGCAACAGGAGCA small insertion Het probably benign phenotype 12/04/2019
[records 1 to 55 of 55]