Incidental Mutations

51 incidental mutations are currently displayed, and affect 43 genes.
0 are Possibly Damaging.
1 are Probably Damaging.
41 are Probably Benign.
8 are Probably Null.
0 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 51 of 51] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 604833 UTSW 4930447C04Rik 0.178 RF041 G1 103.46 N 12 72881276 (GRCm38) TGAGGA TGA small deletion Het probably benign phenotype 2019-12-04
2 604816 UTSW 5430401F13Rik 0.073 RF041 G1 217.47 N 6 131552873 (GRCm38) CCAGCAAAAACAGAAAGGAAAAGG CCAGCAAAAACAGAAAGGAAAAGGAGGCCAGCAAAAACAGAAAGGAAAAGG small insertion Het probably benign 2019-12-04
3 604817 UTSW 5430401F13Rik 0.073 RF041 G1 185.47 N 6 131552892 (GRCm38) AAAGGTGGC AAAGGTGGCAAGCAAAAACAGAAAGGAGAAGGTGGC small insertion Het probably benign 2019-12-04
4 604818 UTSW 5430401F13Rik 0.073 RF041 G1 217.47 N 6 131552894 (GRCm38) AGGTGGCCAG AGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG small insertion Het probably benign 2019-12-04
5 604840 UTSW Abcf1 0.957 RF041 G1 127.47 N 17 35963201 (GRCm38) CTCTTC CTC unclassified Het probably benign phenotype 2019-12-04
6 604813 UTSW Acap3 0.108 RF041 G1 217.47 N 4 155905100 (GRCm38) GGCTGC GGCTGCGGCATCCTGTGCTGC small insertion Het probably benign 2019-12-04
7 604846 UTSW AI837181 0.000 RF041 G1 123.47 N 19 5425229 (GRCm38) GGC GGCTGC small insertion Het probably benign 2019-12-04
8 604836 UTSW Arid1b 0.604 RF041 G1 126.47 N 17 4995595 (GRCm38) CGG CGGTGG small insertion Het probably benign phenotype 2019-12-04
9 604822 UTSW AY761185 0.054 RF041 G1 217.47 N 8 20943912 (GRCm38) CACTGTGGG C frame shift Het probably null 2019-12-04
10 604839 UTSW Btnl1 0.000 RF041 G1 225.01 N 17 34381368 (GRCm38) T246M C T missense Het probably benign 0.043 2019-12-04
11 604826 UTSW Cdc40 0.969 RF041 G1 181.01 N 10 40843123 (GRCm38) D337N C T missense Het probably damaging 1.000 phenotype 2019-12-04
12 604823 UTSW Cmtm1 0.367 RF041 G1 129.46 N 8 104309470 (GRCm38) CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT small deletion Het probably benign 0.090 2019-12-04
13 604841 UTSW Cul9 0.214 RF041 G1 214.47 N 17 46500854 (GRCm38) CCT CCTACT nonsense Het probably null phenotype 2019-12-04
14 604805 UTSW Defb22 0.000 RF041 G1 217.47 N 2 152485823 (GRCm38) GCTGGCCTTTGC GCTGGCCTTTGCCGCAGACCTGGCCTTTGC small insertion Het probably benign 2019-12-04
15 604820 UTSW Dmkn 0.075 RF041 G1 217.47 N 7 30767173 (GRCm38) GGGGTGGAAG GGGGTGGAAGGGGTGGAAGTGGTGGAAGGGGTGGAAG small insertion Het probably benign phenotype 2019-12-04
16 604837 UTSW Flywch1 1.000 RF041 G1 217.49 N 17 23762161 (GRCm38) CTCACCCACTCCTGGTGT CTCACCCACTCCTGGTGTGGGGAGGCTACGTAATCACCCACTCCTGGTGT frame shift Het probably null 2019-12-04
17 604838 UTSW Flywch1 1.000 RF041 G1 217.47 N 17 23762177 (GRCm38) GT GTGGGGAGGCTACGTACTCACCCACTCCTGGTTT frame shift Het probably null 2019-12-04
18 604852 UTSW Gabre RF041 G1 137.52 N X 72270049 (GRCm38) CTCCGG CTCCGGATCCGG small insertion Het probably benign 2019-12-04
19 604847 UTSW Gm8369 0.060 RF041 G1 217.47 N 19 11511758 (GRCm38) GTGTGT GTGTGTATGTGT small insertion Het probably benign 2019-12-04
20 604843 UTSW Gykl1 0.393 RF041 G1 225.01 N 18 52694416 (GRCm38) R232Q G A missense Het probably benign 0.062 phenotype 2019-12-04
21 604806 UTSW Il2 RF041 G1 217.47 N 3 37125842 (GRCm38) GG GGGCTTGAAGTGCG unclassified Het probably benign phenotype 2019-12-04
22 604824 UTSW Iqcf4 0.048 RF041 G1 217.47 N 9 106570613 (GRCm38) CTTTTCCTTTT CTTTTCCTTTTCCTTTTCCTTTTCCTTTTACTTTTCATTTTCCTTTT nonsense Het probably null 2019-12-04
23 604811 UTSW Kif12 0.222 RF041 G1 214.46 N 4 63171425 (GRCm38) GGC GGCCTCCACCCGGCGTGC small insertion Het probably benign phenotype 2019-12-04
24 604814 UTSW Kmt2c 1.000 RF041 G1 214.46 N 5 25315775 (GRCm38) TG TGTTGCAG small insertion Het probably benign phenotype 2019-12-04
25 604809 UTSW Lce1m RF041 G1 214.46 N 3 93018141 (GRCm38) CTGCTGCTGCC CTGCTGCTGCCCTTGCTGCTGCC unclassified Het probably benign 2019-12-04
26 604850 UTSW Mamld1 RF041 G1 142.47 N X 71118826 (GRCm38) AGC AGCCGC small insertion Het probably benign phenotype 2019-12-04
27 604851 UTSW Mamld1 RF041 G1 143.47 N X 71118829 (GRCm38) AGC AGCCGC small insertion Het probably benign phenotype 2019-12-04
28 604807 UTSW Med12l 0.238 RF041 G1 213.47 N 3 59275985 (GRCm38) AGC AGCTGC small insertion Het probably benign phenotype 2019-12-04
29 604808 UTSW Med12l 0.238 RF041 G1 215.47 N 3 59275995 (GRCm38) GC GCACC small insertion Het probably benign phenotype 2019-12-04
30 604829 UTSW Nefh 0.000 RF041 G1 217.47 N 11 4941039 (GRCm38) CCTCACCTGGGG CCTCACCTGGGGCCTTGGGCTCACCTGGGG small insertion Het probably benign phenotype 2019-12-04
31 604828 UTSW Nf2 1.000 RF041 G1 214.46 N 11 4829936 (GRCm38) AAAAG A frame shift Het probably null phenotype 2019-12-04
32 604831 UTSW Ngfr 0.636 RF041 G1 126.46 N 11 95587511 (GRCm38) CAGG C small deletion Het probably benign phenotype 2019-12-04
33 604802 UTSW Nusap1 1.000 RF041 G1 217.47 N 2 119627579 (GRCm38) GATACACGTTAGCAGTGAGGAGCAAGCTGA GATACACGTTAGCAGTGAGGAGCAAGCTGATATACACGTTAGCAGTGAGGAGCAAGCTGA small insertion Het probably benign phenotype 2019-12-04
34 604803 UTSW Nusap1 1.000 RF041 G1 207.47 N 2 119627593 (GRCm38) GTGAGGAGCAAGCTGA GTGAGGAGCAAGCTGAAATACACGTTAGCAATGAGGAGCAAGCTGA small insertion Het probably benign phenotype 2019-12-04
35 604804 UTSW Nusap1 1.000 RF041 G1 194.47 N 2 119627607 (GRCm38) GAGA GAGATACACGTTAGCAGTGAGGAGCAAGCTTAGA nonsense Het probably null phenotype 2019-12-04
36 604815 UTSW Phc1 1.000 RF041 G1 217.48 N 6 122323600 (GRCm38) TG TGCTGCGG small insertion Het probably benign phenotype 2019-12-04
37 604819 UTSW Pnmal1 0.070 RF041 G1 217.47 N 7 16961444 (GRCm38) CAACATC CAACATCTCATGATGCACCTGCTTAAACATC nonsense Het probably null 2019-12-04
38 604827 UTSW Ptprb 1.000 RF041 G1 101.46 N 10 116283677 (GRCm38) GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT small deletion Het probably benign phenotype 2019-12-04
39 604821 UTSW Setd1a 1.000 RF041 G1 217.47 N 7 127785332 (GRCm38) GGTGGTGGT GGTGGTGGTCGTGGTGGT unclassified Het probably benign phenotype 2019-12-04
40 604849 UTSW Sfr1 1.000 RF041 G1 183.46 N 19 47732868 (GRCm38) ACCGACTTCACCTGCCGCTCCTCAGCCCAGGGAGAATCCACCATCACCCCCGACTTCACCTGCCGCTCCTCAGCCCAGGGAGAATCCACCATCACCCC ACCGACTTCACCTGCCGCTCCTCAGCCCAGGGAGAATCCACCATCACCCC unclassified Het probably benign 2019-12-04
41 604834 UTSW Slc39a4 1.000 RF041 G1 214.47 N 15 76614866 (GRCm38) TGTGGTC TGTGGTCATCATGATCACCATGGTCACCATGATCACGGTGGTC small insertion Het probably benign phenotype 2019-12-04
42 604848 UTSW Smarca2 0.000 RF041 G1 157.47 N 19 26631021 (GRCm38) AGC AGCCCCTGC unclassified Het probably benign phenotype 2019-12-04
43 604835 UTSW Son 0.958 RF041 G1 119.46 N 16 91656691 (GRCm38) CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC unclassified Het probably benign phenotype 2019-12-04
44 604844 UTSW Tcof1 1.000 RF041 G1 217.47 N 18 60833572 (GRCm38) AGATCCCCTTGGC AGATCCCCTTGGCTGCTGAGATGGGCACTTTCCCAGCGATCCCCTTGGC small insertion Het probably benign phenotype 2019-12-04
45 604845 UTSW Tcof1 1.000 RF041 G1 217.47 N 18 60833576 (GRCm38) CCCCTTG CCCCTTGACTGCTGAGATGGGCACTTTCCCAGAGATGCCCTTG small insertion Het probably benign phenotype 2019-12-04
46 604842 UTSW Tfeb 1.000 RF041 G1 153.47 N 17 47786100 (GRCm38) GCA GCATCA small insertion Het probably benign phenotype 2019-12-04
47 604812 UTSW Tmem59 0.134 RF041 G1 217.47 N 4 107190532 (GRCm38) T TGTTTGTTG critical splice acceptor site Het probably benign phenotype 2019-12-04
48 604830 UTSW Tob1 0.000 RF041 G1 160.47 N 11 94214451 (GRCm38) CACA CACAACA small insertion Het probably benign phenotype 2019-12-04
49 604832 UTSW Ubtf 1.000 RF041 G1 194.47 N 11 102306945 (GRCm38) CTTC CTTCTTC small insertion Het probably benign phenotype 2019-12-04
50 604810 UTSW Unc13b 0.346 RF041 G1 107.47 N 4 43177338 (GRCm38) AGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAG AGCCAGAGCCAGAGCCAGGGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAG small insertion Het probably benign phenotype 2019-12-04
51 604825 UTSW Usp19 0.233 RF041 G1 217.47 N 9 108493988 (GRCm38) GTGTGTGTGTGTGTGTGTGTGTGTGT GTGTGTGTGTGTGTGTGTGTGTGTGTGT critical splice acceptor site Het unknown phenotype 2019-12-04
[records 1 to 51 of 51]