Incidental Mutations

47 incidental mutations are currently displayed, and affect 39 genes.
0 are Possibly Damaging.
0 are Probably Damaging.
39 are Probably Benign.
8 are Probably Null.
0 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 47 of 47] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 604871 UTSW 5430401F13Rik 0.058 RF042 G1 176.47 N 6 131552886 AAAGGAAAAGGTGGCCAG AAAGGAAAAGGTGGCCAGCAAAAACAGGAAGGAAAAGGTGGCCAG small insertion Het probably benign 12/04/2019
2 604853 UTSW A030005L19Rik RF042 G1 202.59 N 1 82913584 GCTGCTG GCTGCTGTGACTGCTG small insertion Het probably benign 12/04/2019
3 604889 UTSW AI837181 0.000 RF042 G1 126.47 N 19 5425217 GGC GGCTGC small insertion Het probably benign 12/04/2019
4 604890 UTSW AI837181 0.000 RF042 G1 151.47 N 19 5425237 CG CGGTG small insertion Het probably benign 12/04/2019
5 604855 UTSW Anapc2 1.000 RF042 G1 214.46 N 2 25272561 GCGGCGGCGGCGAC GC unclassified Het probably benign phenotype 12/04/2019
6 604877 UTSW Cgnl1 0.000 RF042 G1 214.46 N 9 71724715 AGCG AGCGGCG small insertion Het probably benign phenotype 12/04/2019
7 604881 UTSW Cntnap1 0.443 RF042 G1 145.47 N 11 101180305 TTT TTTTGTT critical splice acceptor site Het probably benign phenotype 12/04/2019
8 604886 UTSW Cul9 0.196 RF042 G1 136.46 N 17 46540615 TTCTC TTC frame shift Het probably null phenotype 12/04/2019
9 604876 UTSW Dnmt1 1.000 RF042 G1 217.47 N 9 20910119 GGGGCGGAGCACAGTTCCTACCTCGTT GGGGCGGAGCACAGTTCCTACCTCGTTTTGTGGGCGGAGCACAGTTCCTACCTCGTT nonsense Het probably null phenotype 12/04/2019
10 604873 UTSW Frem3 0.187 RF042 G1 214.46 N 8 80615238 GATC GATCATC small insertion Het probably benign phenotype 12/04/2019
11 604897 UTSW Gab3 0.000 RF042 G1 136.47 N X 75000005 TCT TCTACT small insertion Het probably benign phenotype 12/04/2019
12 604898 UTSW Gab3 0.000 RF042 G1 159.47 N X 75000022 TTC TTCGTC small insertion Het probably benign phenotype 12/04/2019
13 604896 UTSW Gabre RF042 G1 214.67 N X 72270047 GGCTCC GGCTCCTGCTCC small insertion Het probably benign 12/04/2019
14 604891 UTSW Gm8369 0.073 RF042 G1 217.47 N 19 11511773 TGTG TGTGAGTG frame shift Het probably null 12/04/2019
15 604892 UTSW Gm8369 0.073 RF042 G1 217.47 N 19 11511778 GTGTGT GTGTGTTTGTGT small insertion Het probably benign 12/04/2019
16 604888 UTSW Gykl1 0.352 RF042 G1 225.01 N 18 52694416 R232Q G A missense Het probably benign 0.062 phenotype 12/04/2019
17 604867 UTSW Igkv12-89 0.102 RF042 G1 214.54 N 6 68835286 G GCAACGCCAT small insertion Het probably benign 12/04/2019
18 604878 UTSW Iqcf4 0.048 RF042 G1 176.47 N 9 106570605 TCCTTTTCCTTTTCCTTTT TCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTGCCTTTTCCTTTTCCTTTT small insertion Het probably benign 12/04/2019
19 604863 UTSW Kmt2e 1.000 RF042 G1 163.47 N 5 23478509 TTT TTTTCTT critical splice acceptor site Het probably benign phenotype 12/04/2019
20 604854 UTSW Krtap28-10 RF042 G1 216.59 N 1 83042125 CCACAG CCACAGACACAG unclassified Het probably benign 12/04/2019
21 604899 UTSW Las1l RF042 G1 217.47 N X 95940620 CTTCCT CTTCCTTTTCCT small insertion Het probably benign 12/04/2019
22 604884 UTSW Lca5l 0.065 RF042 G1 214.46 N 16 96159297 GCCCTGGCCCTGGCCCC GCCC frame shift Het probably null 12/04/2019
23 604862 UTSW Lce1m RF042 G1 217.47 N 3 93018139 CACTGCTGCTGC CACTGCTGCTGCAACTGCTGCTGC unclassified Het probably benign 12/04/2019
24 604879 UTSW Lypd8 0.069 RF042 G1 217.47 N 11 58390243 CA CAGTTCCCTCGCCTCTGTTACCCCACAAATCACCAATA small insertion Het probably benign phenotype 12/04/2019
25 604894 UTSW Mamld1 RF042 G1 153.47 N X 71118812 GCAACA GCAACAACA small insertion Het probably benign phenotype 12/04/2019
26 604895 UTSW Mamld1 RF042 G1 178.47 N X 71118853 A AGCC small insertion Het probably benign phenotype 12/04/2019
27 604857 UTSW Map1a 0.268 RF042 G1 217.47 N 2 121306287 T TTGCTCCACCTCCAGCTCCAGCTCCAGCTCC small insertion Het probably benign phenotype 12/04/2019
28 604858 UTSW Med12l 0.318 RF042 G1 199.47 N 3 59275956 GCAACA GCAACAACA small insertion Het probably benign phenotype 12/04/2019
29 604859 UTSW Med12l 0.318 RF042 G1 195.47 N 3 59275967 AGC AGCGGC small insertion Het probably benign phenotype 12/04/2019
30 604860 UTSW Med12l 0.318 RF042 G1 205.47 N 3 59275981 CAG CAGAAG small insertion Het probably benign phenotype 12/04/2019
31 604861 UTSW Med12l 0.318 RF042 G1 204.47 N 3 59275995 GC GCATC small insertion Het probably benign phenotype 12/04/2019
32 604893 UTSW Morn4 0.133 RF042 G1 214.46 N 19 42076111 GCAGTGAG GCAGTGAGTCAGTCAGTGAG nonsense Het probably null 12/04/2019
33 604856 UTSW Nusap1 1.000 RF042 G1 217.47 N 2 119627607 GAGA GAGATACACGTTAGCAGTGAGGAGCAAGCTTAGA nonsense Het probably null phenotype 12/04/2019
34 604872 UTSW Opa3 0.086 RF042 G1 106.58 N 7 19255669 GCGGGC GCGGGCGGAGCTGCGGGCGGAGCTGCGGGCGGAGCTACGGGC small insertion Het probably benign phenotype 12/04/2019
35 604866 UTSW Pdia4 0.000 RF042 G1 217.47 N 6 47808306 CTCTTCCTCCT C frame shift Het probably null phenotype 12/04/2019
36 604868 UTSW Reep1 0.000 RF042 G1 195.47 N 6 71707966 CGCCA CGCCAGCCA start codon destroyed Het probably null phenotype 12/04/2019
37 604885 UTSW Sbp 0.058 RF042 G1 217.47 N 17 23945384 AAGA AAGACGCTGACAACAGAGA small insertion Het probably benign 12/04/2019
38 604865 UTSW Sfswap 0.000 RF042 G1 217.47 N 5 129569743 CTCGGCCCA CTCGGCCCAGTCGGCCCA unclassified Het probably benign phenotype 12/04/2019
39 604883 UTSW Slc39a4 1.000 RF042 G1 217.47 N 15 76614871 TC TCATCATGATCACCATGGTCACCATGATCACTGTGGCC small insertion Het probably benign phenotype 12/04/2019
40 604864 UTSW Srpk2 0.000 RF042 G1 149.46 N 5 23525575 ATCCT AT utr 3 prime Het probably benign phenotype 12/04/2019
41 604887 UTSW Tfeb 1.000 RF042 G1 168.47 N 17 47786097 GCA GCACCA small insertion Het probably benign phenotype 12/04/2019
42 604869 UTSW Tgoln1 0.125 RF042 G1 217.47 N 6 72616074 T TCACCTCCCGTGGGCTTGCCAGAAG small insertion Het probably benign 12/04/2019
43 604880 UTSW Tob1 0.000 RF042 G1 180.47 N 11 94214451 CACA CACAACA small insertion Het probably benign phenotype 12/04/2019
44 604882 UTSW Trappc9 0.000 RF042 G1 141.47 N 15 72801283 A AGCTGCTGCTGCTGCT small insertion Het probably benign phenotype 12/04/2019
45 604870 UTSW Tsen2 0.948 RF042 G1 213.47 N 6 115560067 GGA GGATGA small insertion Het probably benign phenotype 12/04/2019
46 604874 UTSW Zfhx3 0.917 RF042 G1 217.47 N 8 108956088 GC GCCACAGCAAC small insertion Het probably benign phenotype 12/04/2019
47 604875 UTSW Zfhx3 0.917 RF042 G1 217.47 N 8 108956098 CAGCAGCA CAGCAGCAAAAGCAGCA small insertion Het probably benign phenotype 12/04/2019
[records 1 to 47 of 47]