Incidental Mutations

23 incidental mutations are currently displayed, and affect 22 genes.
0 are Possibly Damaging.
0 are Probably Damaging.
18 are Probably Benign.
5 are Probably Null.
0 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 23 of 23] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 605151 UTSW Cnpy3 1.000 RF051 G1 185.47 N 17 46736748 CTC CTCATC utr 3 prime Het probably benign phenotype 12/04/2019
2 605144 UTSW Fam71e1 0.103 RF051 G1 217.47 N 7 44500523 GGGTCTGAGGGAGGA GGGTCTGAGGGAGGAAGGCTGGATCCTGGATACCTAGGTCTGAGGGAGGA frame shift Het probably null 12/04/2019
3 605154 UTSW Gabre RF051 G1 214.72 N X 72270049 CTCCGG CTCCGGGTCCGG small insertion Het probably benign 12/04/2019
4 605136 UTSW Gm14399 0.099 RF051 G1 109.01 N 2 175131201 Q254E G C missense Het probably benign 0.005 12/04/2019
5 605139 UTSW Hsdl2 0.000 RF051 G1 217.47 N 4 59610636 TGC TGCCGGAGCAGCCACAGCGGC small insertion Het probably benign 12/04/2019
6 605140 UTSW Hsdl2 0.000 RF051 G1 217.47 N 4 59610650 CAGCTGCAG CAGCTGCAGCAGCAGCCAAAGCTGCAG small insertion Het probably benign 12/04/2019
7 605137 UTSW Il2 RF051 G1 214.46 N 3 37125841 GGG GGGGCTTGAAGTGGG unclassified Het probably benign phenotype 12/04/2019
8 605141 UTSW Kmt2c 1.000 RF051 G1 121.46 N 5 25313479 CCTTCT CCT unclassified Het probably benign phenotype 12/04/2019
9 605135 UTSW Manbal RF051 G1 217.47 N 2 157396012 CGATAGAAT C makesense Het probably null 12/04/2019
10 605134 UTSW Map1a 0.367 RF051 G1 217.47 N 2 121306296 CTCCAGCTCCAGCTCCAGCTCCA CTCCAGCTCCAGCTCCAGCTCCAGCTCCAGATCCAGCTCCAGCTCCAGCTCCA small insertion Het probably benign phenotype 12/04/2019
11 605150 UTSW Mei1 0.292 RF051 G1 160.49 N 15 82070010 GC GCTGGCTGCC frame shift Het probably null phenotype 12/04/2019
12 605138 UTSW Nbea 1.000 RF051 G1 192.46 N 3 56009212 TTTA T critical splice donor site Het probably benign phenotype 12/04/2019
13 605147 UTSW Nefh 0.000 RF051 G1 217.47 N 11 4941054 TGGCC TGGCCGCACCTGGGGCCTCGGCC small insertion Het probably benign phenotype 12/04/2019
14 605148 UTSW Olfr1535 0.063 RF051 G1 217.47 N 13 21555523 GCCAAACCCTGTGAGCAAGCAGTTATAACCATCTTTATGCAAACCCTGTGAGCAAGCAGTTATAACCATCTTTAT GGCAAACCCTGTGAGCAAGCAGTTATAACCATCTTTAT frame shift Het probably null phenotype 12/04/2019
15 605145 UTSW Pde3b 0.000 RF051 G1 214.46 N 7 114534775 GGTGGTGGTG GGTGGTGGTGGTG small insertion Het probably benign phenotype 12/04/2019
16 605143 UTSW Plekhg2 0.438 RF051 G1 122.46 N 7 28362352 GGTG GG frame shift Het probably null 12/04/2019
17 605142 UTSW Rassf6 0.104 RF051 G1 121.47 N 5 90608929 AGCAATGGGGA AGCAATGGGGAATCTGCCTCACTCATGGTCCTGTAGCGCAATGGGGA utr 3 prime Het probably benign phenotype 12/04/2019
18 605153 UTSW Smarca2 0.000 RF051 G1 180.5 N 19 26630988 AGCAGC AGCAGCCGCAGC unclassified Het probably benign phenotype 12/04/2019
19 605155 UTSW Stard8 RF051 G1 193.47 N X 99066524 GAG GAGCAG unclassified Het probably benign phenotype 12/04/2019
20 605152 UTSW Tcof1 1.000 RF051 G1 217.47 N 18 60833579 CTTGGC CTTGGCTGCTGAGATGGGCACTTTCCCAGAGATCCCATTGGC small insertion Het probably benign phenotype 12/04/2019
21 605156 UTSW Tmem28 0.097 RF051 G1 122.47 N X 99821362 GCCGCC GCCGCCACCGCC small insertion Het probably benign phenotype 12/04/2019
22 605149 UTSW Triobp 1.000 RF051 G1 214.46 N 15 78967034 AGCCCCAGGACTCCCTGTGCCCAACGG AGCCCCAGGACTCCCTGTGCCCAACGGAACAGCCCCAGGACTCCCTGTGCCCAACGG small insertion Het probably benign phenotype 12/04/2019
23 605146 UTSW Usp2 0.000 RF051 G1 217.47 N 9 44089129 C CTCATGTGACCTGTTCTTCACTTCT critical splice acceptor site Het probably benign phenotype 12/04/2019
[records 1 to 23 of 23]