Incidental Mutations

21 incidental mutations are currently displayed, and affect 21 genes.
0 are Possibly Damaging.
0 are Probably Damaging.
18 are Probably Benign.
3 are Probably Null.
0 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 21 of 21] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 605175 UTSW A030005L19Rik RF053 G1 132.98 N 1 82913573 TGGCTGCTG TGGCTGCTGGGGCTGCTG small insertion Het probably benign 12/04/2019
2 605188 UTSW Abra 0.238 RF053 G1 217.47 N 15 41866299 TGGC T small deletion Het probably benign phenotype 12/04/2019
3 605182 UTSW Blm 1.000 RF053 G1 217.47 N 7 80512921 CTCCTCCTCCTC CTCCTCCTCCTCATCCTCCTCCTC small insertion Het probably benign phenotype 12/04/2019
4 605185 UTSW Bmp5 0.544 RF053 G1 214.47 N 9 75776374 TGAGGAG T small deletion Het probably benign phenotype 12/04/2019
5 605183 UTSW Cngb1 1.000 RF053 G1 217.47 N 8 95303648 GGCTCTGGCTCTGGCTCTGGCTCTG GG frame shift Het probably null phenotype 12/04/2019
6 605186 UTSW Cyb5r4 0.000 RF053 G1 217.47 N 9 87040422 GGATGTGACAGACACACTGCCCAG GGATGTGACAGACACACTGCCCAGCGATGTGACAGACACACTGCCCAG small insertion Het probably benign phenotype 12/04/2019
7 605194 UTSW Ehbp1l1 1.000 RF053 G1 214.46 N 19 5716002 TCACACCACC T small deletion Het probably benign phenotype 12/04/2019
8 605181 UTSW Kdm3a 0.957 RF053 G1 100.46 N 6 71632049 TTTTT TTTTTT critical splice donor site Het probably benign phenotype 12/04/2019
9 605176 UTSW Krtap28-10 RF053 G1 217.47 N 1 83042278 CAGCCACCACAGC CAGCCACCACAGCCAAAGCCACCACAGC unclassified Het probably benign 12/04/2019
10 605195 UTSW Mamld1 RF053 G1 176.47 N X 71118852 CA CAGAA small insertion Het probably benign phenotype 12/04/2019
11 605177 UTSW Map1a 0.424 RF053 G1 217.47 N 2 121306290 CTCCAGCTCCAGCTCCAGCTCCAGCTCCA CTCCAGCTCCAGCTCCAGCTCCAGCTCCAGATCCAGCTCCAGCTCCAGCTCCAGCTCCA small insertion Het probably benign phenotype 12/04/2019
12 605178 UTSW Med12l 0.315 RF053 G1 195.47 N 3 59275993 CAG CAGAAG small insertion Het probably benign phenotype 12/04/2019
13 605187 UTSW Nefh 0.000 RF053 G1 106.47 N 11 4941014 GACTTGGCCTCACCT GACTTGGCCTCACCTCACCACTTGGCCTCACCT nonsense Het probably null phenotype 12/04/2019
14 605179 UTSW Rap1gds1 0.726 RF053 G1 214.46 N 3 138941657 TCATTTATTATGACCATAC TC frame shift Het probably null phenotype 12/04/2019
15 605193 UTSW Tcof1 1.000 RF053 G1 132.47 N 18 60835747 C CAGA unclassified Het probably benign phenotype 12/04/2019
16 605192 UTSW Tfeb 1.000 RF053 G1 168.44 N 17 47786114 AGC AGCCGC small insertion Het probably benign phenotype 12/04/2019
17 605189 UTSW Trappc9 0.000 RF053 G1 148.47 N 15 72801328 TGCT TGCTGCTGCTGCTGCGGCT small insertion Het probably benign phenotype 12/04/2019
18 605184 UTSW Usp2 0.000 RF053 G1 217.47 N 9 44089129 C CTCATGTGACCTGTTCTTCACTTAA critical splice acceptor site Het probably benign phenotype 12/04/2019
19 605190 UTSW Zfp598 0.967 RF053 G1 217.47 N 17 24680761 CCCACCACCACAACCACCACCACCACCACCAC CCCACCACCACCACCACAACCACCACCACCACCACCAC small insertion Het probably benign phenotype 12/04/2019
20 605180 UTSW Zfp69 0.000 RF053 G1 214.46 N 4 120947347 GTGCCAGGGGTCTCTCCATCATGGGATCCTGCTGCAGGGATGCCAGGGGTCTCTCCATCATGGGATCCTGCTGCAGGGGTGCCAGGGGTCGCTTCATCATGGGATCCTGTTGCAGTGGTGCCAGGGGTCGCTCCATCATGGGATCCTGCTGCAGGGGTGCCAGGGGTC GTGCCAGGGGTCTCTCCATCATGGGATCCTGCTGCAGGGGTGCCAGGGGTCGCTTCATCATGGGATCCTGTTGCAGTGGTGCCAGGGGTCGCTCCATCATGGGATCCTGCTGCAGGGGTGCCAGGGGTC utr 5 prime Het probably benign 12/04/2019
21 605191 UTSW Znrd1as 0.135 RF053 G1 217.47 N 17 36965066 CACCAC CACCACCACCACCACCACCTCTACCAC small insertion Het probably benign 12/04/2019
[records 1 to 21 of 21]