Incidental Mutations

23 incidental mutations are currently displayed, and affect 21 genes.
0 are Possibly Damaging.
0 are Probably Damaging.
19 are Probably Benign.
4 are Probably Null.
0 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 23 of 23] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 605324 UTSW 3110021N24Rik RF058 G1 214.53 N 4 108780629 GAGCGCGGCC G small deletion Het probably benign 12/04/2019
2 605327 UTSW 5430401F13Rik 0.065 RF058 G1 160.47 N 6 131552887 AAGGAAAAGGTGGCCAG AAGGAAAAGGTGGCCAGCAAAAACAGAGAGGAAAAGGTGGCCAG small insertion Het probably benign 12/04/2019
3 605328 UTSW 5430401F13Rik 0.065 RF058 G1 197.47 N 6 131552901 CAG CAGCAAAAACAGAAAGGAAAAGGTGGCCAG small insertion Het probably benign 12/04/2019
4 605332 UTSW Alg9 1.000 RF058 G1 179.47 N 9 50775427 GGC GGCTGC unclassified Het probably benign phenotype 12/04/2019
5 605337 UTSW Arid1b 0.651 RF058 G1 108.47 N 17 4995583 CGGGGG CGGGGGGGG small insertion Het probably benign phenotype 12/04/2019
6 605326 UTSW Chd4 1.000 RF058 G1 214.46 N 6 125122131 GC GCTCCCTC unclassified Het probably benign phenotype 12/04/2019
7 605334 UTSW Chga 0.070 RF058 G1 210.47 N 12 102561416 CAG CAGAAG small insertion Het probably benign phenotype 12/04/2019
8 605325 UTSW Cort 0.000 RF058 G1 214.46 N 4 149125412 GCCCACTCGT G unclassified Het probably benign phenotype 12/04/2019
9 605338 UTSW Flywch1 1.000 RF058 G1 217.47 N 17 23762177 GT GTGGGGAGGCTACGTGCTCACCCGCTCCTGGTAT frame shift Het probably null 12/04/2019
10 605343 UTSW Gab3 0.000 RF058 G1 165.47 N X 75000002 TCT TCTACT small insertion Het probably benign phenotype 12/04/2019
11 605342 UTSW Gabre RF058 G1 214.46 N X 72270063 C CCGGCTG small insertion Het probably benign 12/04/2019
12 605335 UTSW Haus4 0.095 RF058 G1 100.47 N 14 54550035 CACTTAAAAAAAAAA CA critical splice acceptor site Het probably benign phenotype 12/04/2019
13 605322 UTSW Il2 RF058 G1 217.47 N 3 37125817 AG AGGGCTTGAAGTGG unclassified Het probably benign phenotype 12/04/2019
14 605323 UTSW Il2 RF058 G1 217.47 N 3 37125821 CTTGAAGTGG CTTGAAGTGGGGATTGAAGTGG unclassified Het probably benign phenotype 12/04/2019
15 605331 UTSW Kri1 1.000 RF058 G1 217.47 N 9 21281066 TCCTCCTCC TC frame shift Het probably null phenotype 12/04/2019
16 605321 UTSW Krtap28-10 RF058 G1 138.47 N 1 83042262 ACAGCCACCACAGCCACAGCCACCACAGC ACAGCCACCACAGCCCCAGCCACCACAGCCACAGCCACCACAGC unclassified Het probably benign 12/04/2019
17 605341 UTSW Mbd1 0.000 RF058 G1 217.47 N 18 74273609 CGTCTTCGTCTGCATCTGCATCTGCA C frame shift Het probably null phenotype 12/04/2019
18 605333 UTSW Nefh 0.000 RF058 G1 217.47 N 11 4941021 CCTC CCTCGCCTGGGGACTTGGACTC small insertion Het probably benign phenotype 12/04/2019
19 605330 UTSW Rtbdn 0.000 RF058 G1 217.47 N 8 84956172 GCAGCG GCAGCGACAGCG small insertion Het probably benign phenotype 12/04/2019
20 605329 UTSW Setd1a 1.000 RF058 G1 217.47 N 7 127785318 GTGGTGGT GTGGTGGTATTGGTGGT unclassified Het probably benign phenotype 12/04/2019
21 605340 UTSW Treml1 0.000 RF058 G1 102.47 N 17 48359947 ACCT A nonsense Het probably null phenotype 12/04/2019
22 605336 UTSW Triobp 1.000 RF058 G1 217.47 N 15 78967044 CTCCCTGTGCCCAAC CTCCCTGTGCCCAACTGAACAACCCCAGGATTCCCTGTGCCCAAC small insertion Het probably benign phenotype 12/04/2019
23 605339 UTSW Zfp598 0.964 RF058 G1 217.47 N 17 24680761 CCCACCACCACAACCACCACCACCACCACCAC CCCACCACCACCACCACAACCACCACCACCACCACCAC small insertion Het probably benign phenotype 12/04/2019
[records 1 to 23 of 23]