Incidental Mutations

20 incidental mutations are currently displayed, and affect 17 genes.
0 are Possibly Damaging.
0 are Probably Damaging.
16 are Probably Benign.
4 are Probably Null.
0 create premature stop codons.
3 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 20 of 20] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 605428 UTSW Anapc2 1.000 RF062 G1 217.47 N 2 25272537 GTGGCGGCGGCGGC G frame shift Het probably null phenotype 12/04/2019
2 605446 UTSW Ankhd1 0.000 RF062 G1 217.68 N 18 36560918 GGCGGC GGCGGCAGCGGC small insertion Het probably benign 12/04/2019
3 605439 UTSW Cckbr 0.067 RF062 G1 128.46 N 7 105434687 CAG C frame shift Het probably null phenotype 12/04/2019
4 605433 UTSW Defb22 0.000 RF062 G1 217.47 N 2 152485825 TGGCCT TGGCCTCTGCGGCAGAGCCGGCCT small insertion Het probably benign 12/04/2019
5 605437 UTSW Dmkn 0.094 RF062 G1 217.47 N 7 30767175 GGTGGAAGTGGTGGAAGTGGTGGAAGT GGTGGAAGTGGTGGAAGTGGTGGAAGTCGTGGAAGTGGTGGAAGTGGTGGAAGT small insertion Het probably benign phenotype 12/04/2019
6 605434 UTSW Efhd2 0.206 RF062 G1 217.47 N 4 141874755 GCCGCC GCCGCCTCCGCC small insertion Het probably benign phenotype 12/04/2019
7 605435 UTSW Efhd2 0.206 RF062 G1 214.67 N 4 141874774 CC CCGCCGAC small insertion Het probably benign phenotype 12/04/2019
8 605429 UTSW Fsip2 0.110 RF062 G1 170.65 N 2 82984363 TTTT TTTTGTTT critical splice acceptor site Het probably benign phenotype 12/04/2019
9 605430 UTSW Gm11060 0.146 RF062 G1 110.59 N 2 105092040 CTGTGTG CTG frame shift Het probably null 12/04/2019
10 605438 UTSW Gm5591 0.231 RF062 G1 143.51 N 7 38522335 GC G frame shift Het probably null 12/04/2019
11 605443 UTSW Krt10 0.407 RF062 G1 214.46 N 11 99386199 CGCC CGCCGCC unclassified Het probably benign phenotype 12/04/2019
12 605444 UTSW Krt10 0.407 RF062 G1 217.47 N 11 99389264 ACCACCGCC ACCACCGCCACCGCC unclassified Het probably benign phenotype 12/04/2019
13 605442 UTSW Nefh 0.000 RF062 G1 217.47 N 11 4941028 TGGGGACTTGGCCTCACCTGGGGACTTGGCCTC TGGGGACTTGGCCTCACCGGGGGACTTGGCCTCACCTGGGGACTTGGCCTC small insertion Het probably benign phenotype 12/04/2019
14 605431 UTSW Nusap1 1.000 RF062 G1 217.47 N 2 119627601 CAAGCTGAGA CAAGCTGAGATACACGTTAGCAGTGAGGAGGAAGCTGAGA small insertion Het probably benign phenotype 12/04/2019
15 605432 UTSW Nusap1 1.000 RF062 G1 217.47 N 2 119627610 A ATACACGTTAGCAGTGAGGAGCAAGCTGAGG small insertion Het probably benign phenotype 12/04/2019
16 605441 UTSW Rfx4 1.000 RF062 G1 135.47 N 10 84858481 CTCTCTCTCTCTCT CTCTCTCTCTCTCTCTATCTCTCTCTCTCT critical splice acceptor site Het probably benign phenotype 12/04/2019
17 605440 UTSW St5 0.782 RF062 G1 217.47 N 7 109556946 GGGCAGCCCTCACTGA G unclassified Het probably benign phenotype 12/04/2019
18 605445 UTSW Tfeb 1.000 RF062 G1 133.47 N 17 47786100 GCA GCATCA small insertion Het probably benign phenotype 12/04/2019
19 605447 UTSW Tnfaip8 0.209 RF062 G1 217.47 N 18 50046831 ACACACACACACACACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC AC critical splice donor site Het probably benign phenotype 12/04/2019
20 605436 UTSW Zfp384 0.243 RF062 G1 217.47 N 6 125036466 CCCAGGCCCAGGCCCAGGCCCAGG CCCAGGCCCAGGACCAGGCCCAGGCCCAGGCCCAGG unclassified Het probably benign phenotype 12/04/2019
[records 1 to 20 of 20]