Incidental Mutations

27 incidental mutations are currently displayed, and affect 23 genes.
0 are Possibly Damaging.
1 are Probably Damaging.
18 are Probably Benign.
8 are Probably Null.
0 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 27 of 27] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 605460 UTSW 5430401F13Rik 0.073 RF063 G1 217.47 N 6 131552883 (GRCm38) CAGAAAGGAAAAGGTGGCCAG CAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG small insertion Het probably benign 2019-12-04
2 605461 UTSW 5430401F13Rik 0.073 RF063 G1 217.47 N 6 131552884 (GRCm38) AGAAAGGAAAAGGTGGCCAG AGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG small insertion Het probably benign 2019-12-04
3 605449 UTSW Abca2 0.000 RF063 G1 137.01 N 2 25447397 (GRCm38) E2421D G T missense Het probably damaging 0.997 phenotype 2019-12-04
4 605470 UTSW Apc 0.969 RF063 G1 106.47 N 18 34282009 (GRCm38) A AATAAAGCCC critical splice donor site Het probably benign phenotype 2019-12-04
5 605472 UTSW Calhm1 0.000 RF063 G1 217.47 N 19 47141256 (GRCm38) TGGCTGTGGCTG TGGCTGTGGCTGCGGCTGTGGCTG unclassified Het probably benign phenotype 2019-12-04
6 605453 UTSW Casz1 1.000 RF063 G1 170.46 N 4 148952304 (GRCm38) CACA C small deletion Het probably benign phenotype 2019-12-04
7 605466 UTSW Dock4 0.120 RF063 G1 194.47 N 12 40844399 (GRCm38) GTGCCGGTGCCCGT G frame shift Het probably null phenotype 2019-12-04
8 605448 UTSW F11r 0.113 RF063 G1 111.46 N 1 171461190 (GRCm38) CCCCCCCCC CCCCCCCCCCC critical splice acceptor site Het probably benign phenotype 2019-12-04
9 605450 UTSW Fam171b 0.113 RF063 G1 217.47 N 2 83812896 (GRCm38) C CAGCAGA small insertion Het probably benign 2019-12-04
10 605458 UTSW Fbrsl1 0.077 RF063 G1 214.46 N 5 110378139 (GRCm38) GCGTGTGCTGGT GCGTGTGCTGGTACGTGTGCTGGT small insertion Het probably benign 2019-12-04
11 605459 UTSW Fbrsl1 0.077 RF063 G1 214.46 N 5 110378143 (GRCm38) GTGCTGGTG GTGCTGGTGCGTCTGCTGGTG small insertion Het probably benign 2019-12-04
12 605464 UTSW Iqcf4 0.048 RF063 G1 116.47 N 9 106570617 (GRCm38) TCCTTTT TCCTTTTCCTTTTCCTTGTCCTTTTCCTTTTCCTTTGCCTTTT small insertion Het probably benign 2019-12-04
13 605463 UTSW Iqgap1 0.000 RF063 G1 217.47 N 7 80723751 (GRCm38) AGGCCACCACTGCTCACAGGTGCTGTACCT A frame shift Het probably null phenotype 2019-12-04
14 605454 UTSW Kmt2c 1.000 RF063 G1 113.47 N 5 25315764 (GRCm38) GCT GCTCCT small insertion Het probably benign phenotype 2019-12-04
15 605467 UTSW Lrtm1 0.069 RF063 G1 214.46 N 14 29021443 (GRCm38) TAGCCTCAGTGGCC T frame shift Het probably null 2019-12-04
16 605451 UTSW Med12l 0.238 RF063 G1 153.47 N 3 59275958 (GRCm38) AACA AACAACA small insertion Het probably benign phenotype 2019-12-04
17 605452 UTSW Med12l 0.238 RF063 G1 190.47 N 3 59275973 (GRCm38) AGC AGCCGC small insertion Het probably benign phenotype 2019-12-04
18 605457 UTSW Rassf6 0.090 RF063 G1 133.47 N 5 90608942 (GRCm38) C CTGCCTCACTCATGGTCCTGTAGAGCAATGGGGATTA nonsense Het probably null phenotype 2019-12-04
19 605465 UTSW Sh3pxd2b 0.278 RF063 G1 216.47 N 11 32423051 (GRCm38) TGTGCC TGTGCCCGTGCC small insertion Het probably benign phenotype 2019-12-04
20 605455 UTSW Sorcs2 0.000 RF063 G1 217.47 N 5 36153811 (GRCm38) ATACATACATACCT AT frame shift Het probably null phenotype 2019-12-04
21 605474 UTSW Sry 0.318 RF063 G1 217.47 N Y 2662595 (GRCm38) TGCTGCTGCTGCTGCTG T frame shift Het probably null phenotype 2019-12-04
22 605473 UTSW Stard8 0.000 RF063 G1 163.47 N X 99066524 (GRCm38) GAG GAGTAG nonsense Het probably null phenotype 2019-12-04
23 605471 UTSW Tcof1 1.000 RF063 G1 217.47 N 18 60833573 (GRCm38) GATCCCCTTGGC GATCCCCTTGGCTGCTGAGATGGGCACTTTCCCAGATATCCCCTTGGC small insertion Het probably benign phenotype 2019-12-04
24 605456 UTSW Thegl 0.071 RF063 G1 217.47 N 5 77016426 (GRCm38) CCAG CCAGCGATCCTCCCCAGTCCCGCAAGGTCAG small insertion Het probably benign 2019-12-04
25 605468 UTSW Trappc9 0.000 RF063 G1 195.47 N 15 72801320 (GRCm38) GCTGCTGCTGCT GCTGCTGCTGCTGCTTCTGCTGCTGCT small insertion Het probably benign phenotype 2019-12-04
26 605469 UTSW Trappc9 0.000 RF063 G1 217.47 N 15 72801324 (GRCm38) CTGCTGCT CTGCTGCTGCTGCTGTTGCTGCT small insertion Het probably benign phenotype 2019-12-04
27 605462 UTSW Vmn1r74 0.053 RF063 G1 214.46 N 7 11847140 (GRCm38) CAGAGCCACCAAGTACCT C frame shift Het probably null 2019-12-04
[records 1 to 27 of 27]