Incidental Mutations

68 incidental mutations are currently displayed, and affect 57 genes.
4 are Possibly Damaging.
12 are Probably Damaging.
45 are Probably Benign.
6 are Probably Null.
1 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 68 of 68] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 262166 UTSW 4930556J24Rik 0.116 T0975 G3 211 N 714 11 3937945 TAA TAAA frame shift Het probably null 02/04/2015
2 262167 UTSW 4930556J24Rik 0.116 T0975 G3 225 N 714 11 3976324 A27T C T missense Het unknown 02/04/2015
3 262139 UTSW Ago3 0.000 T0975 G3 144 N 714 4 126404263 V155I C T missense Het probably benign 0.000 phenotype 02/04/2015
4 262140 UTSW Ago3 0.000 T0975 G3 97 N 714 4 126404305 A141T C T missense Het probably benign 0.000 phenotype 02/04/2015
5 262141 UTSW Ago3 0.000 T0975 G3 116 N 714 4 126404310 A139V G A missense Het probably benign 0.001 phenotype 02/04/2015
6 262152 UTSW Ahdc1 0.261 T0975 G3 108 N 714 4 133062754 ACCTCCT ACCTCCTCCT small insertion Het probably benign phenotype 02/04/2015
7 262149 UTSW Azin2 0.252 T0975 G3 201 N 714 4 128946134 Y222H A G missense Het probably benign 0.001 phenotype 02/04/2015
8 67716 UTSW Bpifb5 0.000 T0975 G3 225 N 714 2 154229464 C A splice site Het probably null 09/03/2013
9 262168 UTSW Ccdc157 0.060 T0975 G3 84 N 714 11 4146246 A455T C T missense Het probably damaging 0.991 02/04/2015
10 262194 UTSW Ccng1 0.260 T0975 G3 186 N 714 11 40754044 S9A A C missense Het probably benign 0.000 phenotype 02/04/2015
11 67715 UTSW Cfh 0.107 T0975 G3 225 N 714 1 140154598 T164A T C missense Het probably benign 0.045 phenotype 09/03/2013
12 262162 UTSW Cherp 0.962 T0975 G3 154 N 714 8 72462034 TTGGACCTGGACCTGGACCTGGACCTGGA TTGGACCTGGACCTGGACCTGGA small deletion Het probably benign 02/04/2015
13 67714 UTSW Chrng 1.000 T0975 G3 222 N 714 1 87210626 S380P T C missense Het probably benign 0.004 phenotype 09/03/2013
14 262144 UTSW Clspn 1.000 T0975 G3 141 N 714 4 126566437 ACGGCGGCGGCGGCG ACGGCGGCGGCGGCGGCGGCG unclassified Het probably benign phenotype 02/04/2015
15 262161 UTSW Ctrc 0.096 T0975 G3 153 N 714 4 141845196 T TA frame shift Het probably null phenotype 02/04/2015
16 67742 UTSW Cxxc1 1.000 T0975 G3 225 N 714 18 74220921 R593C C T missense Het probably damaging 0.998 0.655 phenotype 09/03/2013
17 67740 UTSW Dlgap1 0.000 T0975 G3 211 N 714 17 70516955 S312P T C missense Het possibly damaging 0.859 09/03/2013
18 67718 UTSW Dnah10 0.000 T0975 G3 225 N 714 5 124763066 S1255G A G missense Het probably benign 0.000 0.090 phenotype 09/03/2013
19 67722 UTSW Dpep1 0.140 T0975 G3 225 N 714 8 123200988 S388C A T missense Het probably damaging 0.991 phenotype 09/03/2013
20 262177 UTSW Emid1 0.110 T0975 G3 180 N 714 11 5128884 L353V A C missense Het probably benign 0.349 02/04/2015
21 262179 UTSW Emid1 0.110 T0975 G3 225 N 714 11 5144386 T42A T C missense Het probably damaging 0.997 02/04/2015
22 67729 UTSW Epn3 0.000 T0975 G3 225 N 714 11 94491907 A G critical splice donor site 2 bp Het probably null phenotype 09/03/2013
23 67713 UTSW Fam124b 0.100 T0975 G3 225 N 714 1 80213126 E180G T C missense Het probably benign 0.056 09/03/2013
24 262199 UTSW Fam135b 0.000 T0975 G3 225 N 714 15 71463885 T487P T G missense Het probably damaging 0.995 02/04/2015
25 262170 UTSW Gatsl3 0.000 T0975 G3 225 N 714 11 4220445 G147A G C missense Het probably benign 0.002 02/04/2015
26 262148 UTSW Gja4 0.000 T0975 G3 225 N 714 4 127312231 H246Q G C missense Het probably benign 0.000 phenotype 02/04/2015
27 262156 UTSW Gm7534 0.067 T0975 G3 217 N 714 4 134202629 GTG GTGCTG small insertion Het probably benign 02/04/2015
28 262195 UTSW Gm9972 0.121 T0975 G3 217 N 714 11 43036770 GA GAA frame shift Het probably null 02/04/2015
29 262193 UTSW Hmmr 0.000 T0975 G3 166 N 714 11 40723416 N148K G C missense Het probably damaging 0.995 phenotype 02/04/2015
30 67732 UTSW Homez 0.000 T0975 G3 225 N 714 14 54857339 R304K C T missense Het possibly damaging 0.852 09/03/2013
31 67725 UTSW Ifngr1 0.000 T0975 G3 225 N 714 10 19609473 V407M G A missense Het probably damaging 0.977 phenotype 09/03/2013
32 262164 UTSW Inpp5j 0.499 T0975 G3 225 N 714 11 3502527 T241N G T missense Het possibly damaging 0.691 phenotype 02/04/2015
33 262134 UTSW Kif12 0.265 T0975 G3 101 N 714 4 63171423 GGGGC GGGGCCTCCACCCGGCGGGC small insertion Het probably benign phenotype 02/04/2015
34 262180 UTSW Kremen1 0.107 T0975 G3 151 N 714 11 5195105 A424T C T missense Het probably benign 0.021 phenotype 02/04/2015
35 262190 UTSW Mat2b 0.352 T0975 G3 190 N 714 11 40680091 T302I G A missense Het probably benign 0.025 phenotype 02/04/2015
36 262172 UTSW Mtmr3 0.000 T0975 G3 169 N 714 11 4488441 R671K C T missense Het probably benign 0.000 phenotype 02/04/2015
37 262183 UTSW Nacad 0.000 T0975 G3 152 N 714 11 6599750 GCAGGGTCAGGGTC GCAGGGTCAGGGTCAGGGTC small insertion Het probably benign 02/04/2015
38 262184 UTSW Nacad 0.000 T0975 G3 210 N 714 11 6601622 N523S T C missense Het probably benign 0.026 02/04/2015
39 262185 UTSW Nacad 0.000 T0975 G3 205 N 714 11 6601632 C520R A G missense Het probably benign 0.169 02/04/2015
40 262175 UTSW Nefh 0.000 T0975 G3 225 N 714 11 4940151 P823S G A missense Het probably benign 0.001 phenotype 02/04/2015
41 67723 UTSW Nfrkb 0.712 T0975 G3 225 N 714 9 31397083 A230P G C missense Het probably benign 0.043 09/03/2013
42 67720 UTSW Nlrp4a 0.119 T0975 G3 225 N 714 7 26449637 E223G A G missense Het probably damaging 1.000 0.572 09/03/2013
43 67737 UTSW Notch3 0.000 T0975 G3 162 N 714 17 32146417 Y1107F T A missense Het probably damaging 0.991 phenotype 09/03/2013
44 262137 UTSW Olfr1331 0.060 T0975 G3 148 N 714 4 118869303 R174M G T missense Het probably benign 0.018 phenotype 02/04/2015
45 67721 UTSW Olfr309 0.060 T0975 G3 225 N 714 7 86306284 Y276* A T nonsense Het probably null phenotype 09/03/2013
46 67727 UTSW Olfr781 0.109 T0975 G3 225 N 714 10 129333445 D188G A G missense Het probably benign 0.307 phenotype 09/03/2013
47 262171 UTSW Osm 0.000 T0975 G3 188 N 714 11 4239588 D124G A G missense Het probably benign 0.016 phenotype 02/04/2015
48 262160 UTSW Plekhm2 0.000 T0975 G3 217 N 714 4 141631981 TTCCTCCTCCT TTCCTCCT small deletion Het probably benign phenotype 02/04/2015
49 262135 UTSW Pomgnt1 0.000 T0975 G3 225 N 714 4 116137427 C T unclassified Het probably benign phenotype 02/04/2015
50 262158 UTSW Spen 1.000 T0975 G3 225 N 714 4 141474353 V2321A A G missense Het probably benign 0.326 phenotype 02/04/2015
51 262153 UTSW Sytl1 0.000 T0975 G3 136 N 714 4 133256994 TCTGC TC small deletion Het probably benign phenotype 02/04/2015
52 262165 UTSW Tcn2 0.065 T0975 G3 225 N 714 11 3923487 F286L G C missense Het possibly damaging 0.785 phenotype 02/04/2015
53 67733 UTSW Tg 0.134 T0975 G3 225 N 714 15 66688863 S10P T C missense Het probably benign 0.014 0.143 phenotype 09/03/2013
54 67736 UTSW Tmprss7 0.113 T0975 G3 225 N 714 16 45680733 R235Q C T missense Het probably benign 0.000 0.090 09/03/2013
55 262187 UTSW Tns3 0.284 T0975 G3 220 N 714 11 8451146 L1051M G T missense Het probably benign 0.005 phenotype 02/04/2015
56 262188 UTSW Tns3 0.284 T0975 G3 209 N 714 11 8479518 E806A T G missense Het probably benign 0.000 phenotype 02/04/2015
57 262189 UTSW Tns3 0.284 T0975 G3 225 N 714 11 8549100 G A start gained Het probably benign phenotype 02/04/2015
58 262136 UTSW Toe1 1.000 T0975 G3 225 N 714 4 116806093 I62M T C missense Het probably benign 0.002 02/04/2015
59 67734 UTSW Txnrd2 1.000 T0975 G3 195 N 714 16 18475565 H436R A G missense Het probably damaging 1.000 phenotype 09/03/2013
60 67717 UTSW Ubr4 1.000 T0975 G3 194 N 714 4 139451781 P2001S C T missense Het probably damaging 0.998 0.160 phenotype 09/03/2013
61 67719 UTSW Vmn2r23 0.063 T0975 G3 225 N 714 6 123713161 M332K T A missense Het probably benign 0.005 09/03/2013
62 262150 UTSW Zbtb8a 0.246 T0975 G3 151 N 714 4 129360019 GG GGATG small insertion Het probably benign 02/04/2015
63 262151 UTSW Zbtb8a 0.246 T0975 G3 225 N 714 4 129360212 H163R T C missense Het probably benign 0.000 02/04/2015
64 67730 UTSW Zfyve21 0.000 T0975 G3 153 N 714 12 111827633 D206G A G missense Het probably damaging 1.000 09/03/2013
65 262198 UTSW Zkscan4 0.081 T0975 G3 172 N 714 13 21479200 AGAGGAG AGAG small deletion Het probably benign 02/04/2015
66 262145 UTSW Zmym1 0.184 T0975 G3 225 N 714 4 127047947 D785N C T missense Het probably benign 0.002 02/04/2015
67 262146 UTSW Zmym1 0.184 T0975 G3 225 N 714 4 127048250 V684I C T missense Het probably benign 0.007 02/04/2015
68 262147 UTSW Zmym1 0.184 T0975 G3 225 N 714 4 127049673 H307Q A C missense Het probably benign 0.051 02/04/2015
[records 1 to 68 of 68]