Incidental Mutations

7 incidental mutations are currently displayed, and affect 7 genes.
1 are Possibly Damaging.
2 are Probably Damaging.
4 are Probably Benign.
0 are Probably Null.
0 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 7 of 7] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 197497 UTSW Aak1 0.492 Y4335 102 N 6 86959142 ACAGCAGCAGCAGCAGCAGCAGCAGC ACAGCAGCAGCAGCAGCAGCAGC small deletion Het probably benign phenotype 05/23/2014
2 226075 UTSW Hsh2d 0.048 Y4335 225 N 8 72200460 D229N G A missense Het probably benign 0.006 0.086 phenotype 09/11/2014
3 197501 UTSW Naip1 0.000 Y4335 225 N 13 100425522 R1045L C A missense Het probably benign 0.001 phenotype 05/23/2014
4 197500 UTSW Nckipsd 0.286 Y4335 225 N 9 108817545 R649C C T missense Het probably damaging 1.000 phenotype 05/23/2014
5 197498 UTSW Rsf1 1.000 Y4335 214 N 7 97579904 ATGGCG ATGGCGACGGTGGCG unclassified Het probably benign phenotype 05/23/2014
6 197499 UTSW Tpcn2 0.000 Y4335 225 N 7 145257235 Y575C T C missense Het probably damaging 0.991 phenotype 05/23/2014
7 226074 UTSW Unc80 0.868 Y4335 225 N 1 66521581 H823Y C T missense Het possibly damaging 0.462 phenotype 09/11/2014
[records 1 to 7 of 7]