Incidental Mutations

468,083 incidental mutations are currently displayed, and affect 22,326 genes.
73,743 are Possibly Damaging.
171,086 are Probably Damaging.
162,804 are Probably Benign.
49,366 are Probably Null.
19,380 create premature stop codons.
13,243 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
|< first << previous [records 463001 to 463022 of 463022] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
463001 91530 APN Zfp772 0.077 IGL01589 G1 7 7205524 F107S A G missense Het possibly damaging 0.533 12/09/2013
463002 555732 UTSW Zfp772 0.077 PIT4449001 G1 209.01 N 7 7204351 I114V T C missense Het probably benign 0.029 06/07/2019
463003 216572 UTSW Zfp772 0.077 R1945 G1 225 N 7 7203630 I354T A G missense Het probably benign 0.008 08/01/2014
463004 265577 UTSW Zfp772 0.077 R3085 G1 225 Y 7 7203700 R331G T C missense Het possibly damaging 0.533 0.306 02/05/2015
463005 405600 UTSW Zfp772 0.077 R5300 G1 117 N 7 7204158 M178K A T missense Het probably benign 0.000 07/22/2016
463006 447071 UTSW Zfp772 0.077 R5793 G1 94 N 7 7204284 T136I G A missense Het probably benign 0.001 12/15/2016
463007 506282 UTSW Zfp772 0.077 R6252 G1 225.01 N 7 7204019 S224R G T missense Het possibly damaging 0.856 03/15/2018
463008 525584 UTSW Zfp772 0.077 R6605 G1 146.01 Y 7 7205548 E99G T C missense Het possibly damaging 0.719 0.116 06/22/2018
463009 530767 UTSW Zfp772 0.077 R6751 G1 225.01 Y 7 7203717 R325Q C T missense Het possibly damaging 0.901 0.179 08/01/2018
463010 533844 UTSW Zfp772 0.077 R6812 G1 97.01 Y 7 7206308 D61G T C missense Het possibly damaging 0.922 0.321 09/12/2018
463011 14998 APN Zfp773 0.072 IGL00764 G1 7 7132684 K304N T G missense Het probably damaging 1.000 12/06/2012
463012 14999 APN Zfp773 0.072 IGL00780 G1 7 7133114 Q161L T A missense Het probably benign 0.001 12/06/2012
463013 75140 APN Zfp773 0.072 IGL01348 G1 7 7135315 V107D A T missense Het possibly damaging 0.932 10/07/2013
463014 285267 APN Zfp773 0.072 IGL02224 7 7132976 H207R T C missense Het probably benign 0.004 04/16/2015
463015 294056 APN Zfp773 0.072 IGL02447 7 7136656 G T utr 5 prime Het probably benign 04/16/2015
463016 362478 APN Zfp773 0.072 IGL02869 7 7134233 T121A T C missense Het probably benign 0.225 12/18/2015
463017 47469 UTSW Zfp773 0.072 R0505 G1 225 Y 7 7133024 D191G T C missense Het probably benign 0.025 0.090 06/12/2013
463018 55709 UTSW Zfp773 0.072 R0585 G1 225 Y 7 7132575 I341L T A missense Het probably benign 0.210 0.090 07/11/2013
463019 76313 UTSW Zfp773 0.072 R0804 G1 109 N 7 7133093 AGCTGCTGCTGCTGCTGCTGCTGCTGC AGCTGCTGCTGCTGCTGCTGCTGC intron Het probably benign 10/16/2013
463020 77372 UTSW Zfp773 0.072 R0846 G1 225 N 7 7132692 C302S A T missense Het probably damaging 1.000 10/16/2013
463021 100222 UTSW Zfp773 0.072 R1179 G1 147 N 7 7133093 AGCTGCTGCTGCTGCTGCTGCTGCTGC AGCTGCTGCTGCTGCTGCTGCTGC intron Het probably benign 01/15/2014
463022 251691 UTSW Zfp773 0.072 R2847 G1 108 N 7 7133093 AGCTGCTGCTGCTGCTGCTGCTGCTGC AGCTGCTGCTGCTGCTGCTGCTGC intron Het probably benign 12/04/2014
463023 277157 UTSW Zfp773 0.072 R3841 G1 225 Y 7 7132391 V402A A G missense Het possibly damaging 0.924 0.256 04/06/2015
463024 314632 UTSW Zfp773 0.072 R4116 G1 109 N 7 7133093 AGCTGCTGCTGCTGCTGCTGCTGCTGC AGCTGCTGCTGCTGCTGCTGCTGC intron Het probably benign 05/14/2015
463025 350794 UTSW Zfp773 0.072 R4638 G1 225 Y 7 7135336 Y100F T A missense Het probably damaging 0.996 0.529 10/08/2015
463026 393546 UTSW Zfp773 0.072 R5126 G1 225 N 7 7136624 T9A T C missense Het unknown 06/15/2016
463027 488625 UTSW Zfp773 0.072 R6142 G1 225.01 Y 7 7132482 T372A T C missense Het probably benign 0.001 0.090 10/10/2017
463028 548956 UTSW Zfp773 0.072 R7072 G1 225.01 Y 7 7132875 C241S A T missense Het probably benign 0.154 05/15/2019
463029 562545 UTSW Zfp773 0.072 R7232 G1 225.01 Y 7 7132985 M204K A T missense Het probably benign 0.145 06/26/2019
463030 64287 UTSW Zfp775 0.119 R0051 G1 225 Y 6 48620772 T527A A G missense Het probably benign 0.000 0.090 08/06/2013
463031 192009 UTSW Zfp775 0.119 R1694 G1 151 N 6 48619455 T88A A G missense Het possibly damaging 0.528 05/14/2014
463032 319589 UTSW Zfp775 0.119 R4178 G1 225 N 6 48613253 A G unclassified 3 bp Het probably null 06/10/2015
463033 480883 UTSW Zfp775 0.119 R5992 G1 209.01 N 6 48619816 R208Q G A missense Het probably damaging 1.000 06/26/2017
463034 520409 UTSW Zfp775 0.119 R6536 G1 225.01 Y 6 48619609 K139R A G missense Het probably damaging 0.998 06/06/2018
463035 539786 UTSW Zfp775 0.119 R6924 G1 225.01 Y 6 48619655 H154Q T A missense Het probably damaging 1.000 0.647 11/06/2018
463036 560232 UTSW Zfp775 0.119 R7200 G1 225.01 N 6 48620481 C430S T A missense Het possibly damaging 0.465 06/26/2019
463037 458753 UTSW Zfp775 0.119 Z1088 214 N 6 48620688 E499K G A missense Het probably damaging 0.995 02/27/2017
463038 89703 APN Zfp777 0.296 IGL01530 G1 6 48043984 S279C T A missense Het probably damaging 1.000 12/03/2013
463039 179946 APN Zfp777 0.296 IGL01916 G1 6 48025342 R649S G T missense Het probably damaging 0.995 05/07/2014
463040 182321 APN Zfp777 0.296 IGL01959 G1 6 48044341 F116L A G missense Het probably benign 0.000 05/07/2014
463041 282770 APN Zfp777 0.296 IGL02167 6 48044526 G54D C T missense Het probably damaging 0.982 04/16/2015
463042 411062 APN Zfp777 0.296 IGL03150 6 48044125 W232R A G missense Het probably damaging 0.999 08/02/2016
463043 66088 UTSW Zfp777 0.296 R0238 G1 225 N 6 48024969 E773G T C missense Het probably damaging 0.989 0.204 08/19/2013
463044 30534 UTSW Zfp777 0.296 R0372 G1 225 Y 6 48044476 M71V T C missense Het possibly damaging 0.619 0.062 04/24/2013
463045 72446 UTSW Zfp777 0.296 R0762 G1 216 Y 6 48029360 V411M C T missense Het probably damaging 0.998 0.151 09/30/2013
463046 158290 UTSW Zfp777 0.296 R1300 G1 225 N 6 48025770 E506G T C missense Het probably benign 0.428 02/18/2014
463047 198226 UTSW Zfp777 0.296 R1727 G1 225 Y 6 48043890 F266Y A T missense Het probably damaging 0.989 0.154 05/23/2014
463048 214368 UTSW Zfp777 0.296 R1906 G1 225 N 6 48042061 M313R A C missense Het probably damaging 0.988 07/14/2014
463049 222092 UTSW Zfp777 0.296 R2047 G1 225 Y 6 48044346 I114T A G missense Het probably benign 0.000 0.090 08/25/2014
463050 230310 UTSW Zfp777 0.296 R2097 G1 225 Y 6 48044242 D149N C T missense Het probably benign 0.075 0.061 09/18/2014
463051 239368 UTSW Zfp777 0.296 R2211 G1 225 N 6 48043885 I312V T C missense Het possibly damaging 0.785 10/15/2014
463052 261352 UTSW Zfp777 0.296 R2898 G1 225 N 6 48025660 E543K C T missense Het probably damaging 0.966 01/23/2015
463053 264147 UTSW Zfp777 0.296 R3123 G1 225 Y 6 48029116 A G unclassified Het probably benign 0.090 02/05/2015
463054 274053 UTSW Zfp777 0.296 R3832 G1 225 Y 6 48044215 T158A T C missense Het probably benign 0.001 0.090 04/02/2015
463055 312679 UTSW Zfp777 0.296 R4019 G1 225 N 6 48042112 Q296L T A missense Het probably damaging 0.995 04/30/2015
463056 316618 UTSW Zfp777 0.296 R4077 G1 225 Y 6 48025522 S589G T C missense Het probably benign 0.000 0.071 05/15/2015
463057 329426 UTSW Zfp777 0.296 R4471 G1 225 Y 6 48042107 W342R A T missense Het probably damaging 0.999 0.957 07/21/2015
463058 389188 UTSW Zfp777 0.296 R5021 G1 225 Y 6 48042127 V291A A G missense Het probably damaging 0.994 0.488 06/06/2016
463059 453348 UTSW Zfp777 0.296 R5030 G1 225 Y 6 48037667 D368E G T missense Het probably damaging 0.987 0.229 02/01/2017
463060 449218 UTSW Zfp777 0.296 R5819 G1 225 N 6 48037588 E395K C T missense Het probably damaging 0.987 12/20/2016
463061 521015 UTSW Zfp777 0.296 R6544 G1 225.01 Y 6 48044485 S68T A T missense Het probably damaging 0.976 0.063 06/06/2018
463062 528410 UTSW Zfp777 0.296 R6736 G1 154.01 N 6 48024856 K811Q T G missense Het probably damaging 0.991 07/24/2018
463063 542244 UTSW Zfp777 0.296 R6971 G1 119.01 Y 6 48024691 A866S C A missense Het probably damaging 0.995 0.116 11/28/2018
463064 563138 UTSW Zfp777 0.296 R7240 G1 225.01 Y 6 48044449 S80P A G missense Het probably benign 0.001 06/26/2019
463065 564413 UTSW Zfp777 0.296 R7258 G1 215.01 Y 6 48025797 E453G T C missense Het probably damaging 0.994 06/26/2019
463066 587133 UTSW Zfp777 0.296 R7586 G1 225.01 N 6 48029218 M414K A T missense Het probably benign 0.331 10/24/2019
463067 53706 APN Zfp78 0.078 IGL01023 G1 7 6375588 G77D G A missense Het possibly damaging 0.901 06/28/2013
463068 47196 UTSW Zfp78 0.078 R0502 G1 225 Y 7 6373158 D22G A G missense Het probably damaging 1.000 0.647 06/12/2013
463069 63089 UTSW Zfp78 0.078 R0704 G1 103 N 7 6379252 C402S T A missense Het probably damaging 1.000 07/30/2013
463070 95531 UTSW Zfp78 0.078 R1035 G1 225 Y 7 6378661 V237F G T missense Het probably damaging 0.997 0.647 01/05/2014
463071 188569 UTSW Zfp78 0.078 R1402 G1 225 N 7 6378619 H223N C A missense Het probably damaging 1.000 05/09/2014
463072 210047 UTSW Zfp78 0.078 R1908 G1 225 N 7 6378898 P316S C T missense Het probably damaging 0.966 06/30/2014
463073 217672 UTSW Zfp78 0.078 R1955 G1 225 N 7 6378559 T203A A G missense Het probably benign 0.004 08/01/2014
463074 223364 UTSW Zfp78 0.078 R2004 G1 225 N 7 6379075 C343S T A missense Het probably damaging 1.000 08/25/2014
463075 220420 UTSW Zfp78 0.078 R2025 G1 225 N 7 6375514 T A splice site Het probably null 08/25/2014
463076 247434 UTSW Zfp78 0.078 R2357 G1 225 Y 7 6379057 G369R G A missense Het probably damaging 1.000 0.647 11/11/2014
463077 430731 UTSW Zfp78 0.078 R5503 G1 225 Y 7 6378529 W161R T A missense Het probably benign 0.000 0.090 10/05/2016
463078 530487 UTSW Zfp78 0.078 R6742 G1 225.01 Y 7 6378278 E109G A G missense Het probably damaging 0.974 08/01/2018
463079 544198 UTSW Zfp78 0.078 R6996 G1 225.01 N 7 6378765 S271R C A missense Het probably benign 0.377 05/13/2019
463080 15000 APN Zfp780b 0.062 IGL00782 G1 7 27964761 D123G T C missense Het probably benign 0.000 12/06/2012
463081 418241 APN Zfp780b 0.062 IGL03088 7 27962992 V713I C T missense Het possibly damaging 0.837 08/02/2016
463082 413315 APN Zfp780b 0.062 IGL03211 7 27963175 C652S A T missense Het possibly damaging 0.931 08/02/2016
463083 35695 UTSW Zfp780b 0.062 R0403 G1 122 N 7 27971689 V65F C A missense Het possibly damaging 0.465 05/09/2013
463084 161877 UTSW Zfp780b 0.062 R1458 G1 225 Y 7 27964827 N101I T A missense Het probably damaging 0.988 0.449 03/14/2014
463085 169846 UTSW Zfp780b 0.062 R1550 G1 202 N 7 27964857 D91G T C missense Het probably benign 0.000 04/13/2014
463086 192014 UTSW Zfp780b 0.062 R1694 G1 225 N 7 27964383 H249L T A missense Het possibly damaging 0.860 05/14/2014
463087 206571 UTSW Zfp780b 0.062 R1823 G1 225 Y 7 27963100 C677S A T missense Het possibly damaging 0.931 0.918 06/23/2014
463088 232774 UTSW Zfp780b 0.062 R2113 G1 205 N 7 27963873 D419G T C missense Het possibly damaging 0.845 09/18/2014
463089 265634 UTSW Zfp780b 0.062 R3086 G1 225 Y 7 27963630 I500T A G missense Het probably damaging 0.962 0.321 02/05/2015
463090 345236 UTSW Zfp780b 0.062 R4620 G1 225 Y 7 27962753 Y792* A T nonsense Het probably null 0.976 09/25/2015
463091 391118 UTSW Zfp780b 0.062 R5023 G1 225 Y 7 27963448 K561E T C missense Het possibly damaging 0.879 0.179 06/06/2016
463092 484479 UTSW Zfp780b 0.062 R5521 G1 68 Y 7 27974748 C A splice site 5 bp Het probably null 0.976 07/21/2017
463093 438503 UTSW Zfp780b 0.062 R5582 G1 225 Y 7 27964827 N101I T A missense Het probably damaging 0.988 0.449 10/26/2016
463094 442792 UTSW Zfp780b 0.062 R5677 G1 225 N 7 27962799 H777P T G missense Het probably benign 0.326 11/09/2016
463095 446051 UTSW Zfp780b 0.062 R5762 G1 225 N 7 27964818 N104S T C missense Het probably benign 0.000 11/21/2016
463096 480675 UTSW Zfp780b 0.062 R5998 G1 225.01 N 7 27964622 K169N T A missense Het probably benign 0.066 06/26/2017
463097 486571 UTSW Zfp780b 0.062 R6036 G1 225.01 N 7 27963568 Y521H A G missense Het probably damaging 0.989 08/16/2017
463098 483501 UTSW Zfp780b 0.062 R6050 G1 225.01 N 7 27964302 I276N A T missense Het probably damaging 0.979 07/14/2017
463099 528813 UTSW Zfp780b 0.062 R6702 G1 225.01 N 7 27971641 T81A T C missense Het possibly damaging 0.907 07/24/2018
463100 528283 UTSW Zfp780b 0.062 R6703 G1 225.01 N 7 27971641 T81A T C missense Het possibly damaging 0.907 07/24/2018
|< first << previous [records 463001 to 463022 of 463022]