Incidental Mutations

500,473 incidental mutations are currently displayed, and affect 22,384 genes.
78,558 are Possibly Damaging.
181,550 are Probably Damaging.
174,062 are Probably Benign.
53,471 are Probably Null.
20,810 create premature stop codons.
14,347 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 500473] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 543419 UTSW Abcc12 0.076 R6518 G1 225.01 Y 8 86509089 A G Het phenotype 11/29/2018
2 578164 UTSW App 0.653 R7456 G1 225.01 N 16 85173560 G A Het phenotype 10/07/2019
3 559285 UTSW Arid1a 1.000 R7186 G1 107.47 N 4 133753233 TGCCGCCGCCGCCGCCGCCGCCG TGCCGCCGCCGCCGCCGCCG Het phenotype 06/26/2019
4 565277 UTSW Atp9a 0.000 R7271 G1 225.01 N 2 168734127 G A Het 06/26/2019
5 531241 UTSW Ccdc171 0.154 PIT4131001 G1 50 Y 4 83661709 C T Het phenotype 08/10/2018
6 603993 UTSW Cfap46 0.000 RF023 G1 214.48 N 7 139638918 TCTTCTCCCTCTCCTTCTCCTTCTCCTTCTCC TCTTCTCCTTCTCCTTCTCC Het 12/04/2019
7 548434 UTSW Decr1 0.655 R7064 G1 225.01 N 4 15945392 C A Het phenotype 05/13/2019
8 531244 UTSW Efcab5 0.095 PIT4131001 G1 50 Y 11 77137691 C T Het 08/10/2018
9 535642 UTSW Eml5 0.275 R6375 G1 225.01 Y 12 98798868 T C Het 0.087 09/21/2018
10 573387 UTSW Ephx2 0.359 R7390 G1 166.01 N 14 66110455 G A Het phenotype 09/13/2019
11 543461 UTSW Espn 0.348 R6551 G1 225.01 Y 4 152128766 T C Het phenotype 01/04/2019
12 532071 UTSW Fam129b 0.183 R6769 G1 143.01 N 2 32895654 C T Het 08/29/2018
13 540699 UTSW Fbxo44 0.000 R6498 G1 150.01 Y 4 148154425 C T Het phenotype 11/09/2018
14 615892 UTSW Fgfr2 1.000 R7246 G1 225.01 Y 7 130242406 T C Het phenotype 01/08/2020
15 539760 UTSW Fkbp2 R6923 G1 225.01 N 19 6979169 A G Het phenotype 11/06/2018
16 548491 UTSW Frmd4a 0.158 R7065 G1 225.01 N 2 4566112 G A Het phenotype 05/13/2019
17 531250 UTSW Gbp11 0.059 R6336 G1 225.01 Y 5 105325489 A G Het 08/17/2018
18 591850 UTSW Gckr 0.000 R7665 G1 225.01 N 5 31297555 T C Het phenotype 11/12/2019
19 18413 UTSW Gm10573 R0058 G1 Y 4 121920736 G A Het 03/25/2013
20 102937 APN Gm12588 IGL01655 G1 11 121907951 T A Het 01/21/2014
21 285860 APN Gm12588 IGL02234 11 121908325 T A Het 04/16/2015
22 583184 UTSW Gm13089 0.065 R7529 G1 200.01 N 4 143702674 T C Het 10/17/2019
23 292899 APN Gm14178 IGL02426 11 99747515 T C Het 04/16/2015
24 296237 APN Gm14179 IGL02504 11 99743177 A T Het 04/16/2015
25 297832 APN Gm14179 IGL02546 11 99743193 A T Het 04/16/2015
26 17067 UTSW Gm19618 R0066 G1 Y 6 87714245 A T Het 01/20/2013
27 16283 UTSW Gm19685 R0060 G1 Y 17 60768423 T C Het 01/20/2013
28 16229 UTSW Gm19993 R0053 G1 Y 1 19835048 A G Het 01/08/2013
29 531238 UTSW Gm32647 R6136 G1 216.01 Y 7 94475732 C T Het 0.087 08/07/2018
30 531239 UTSW Gm45704 R6144 G1 172.01 Y 8 72784292 T A Het 08/07/2018
31 111 UTSW Gm8251 0.099 D3080 Y grasshopper 1 44067335 C A Het 03/11/2010
32 292284 APN Gm9631 IGL02411 11 121943652 G A Het 04/16/2015
33 292474 APN Gm9631 IGL02417 11 121943652 G A Het 04/16/2015
34 292569 APN Gm9631 IGL02419 11 121943652 G A Het 04/16/2015
35 292613 APN Gm9631 IGL02420 11 121943652 G A Het 04/16/2015
36 18 UTSW Gm9943 A9681 G3 Y atchoum 17 16014992 T A Het 11/10/2009
37 615891 UTSW Gtf3c1 1.000 R7246 G1 225.01 Y 7 125669094 T A Het phenotype 01/08/2020
38 539380 UTSW Hps1 0.372 R6916 G1 120.47 N 19 42766725 ATCCTCCTCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC Het phenotype 11/06/2018
39 535653 UTSW Lgals4 0.000 R6431 G1 225.01 Y 7 28840692 G T Het phenotype 09/27/2018
40 540707 UTSW Maml3 0.000 R6885 G1 109.47 N 3 51697579 TCTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGCTGTTGCTGCTGCTGC TCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGCTGTTGCTGCTGCTGC Het phenotype 11/16/2018
41 535566 UTSW Mbd1 0.000 R6861 G1 217.47 N 18 74273574 GTCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGC GTCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGC Het phenotype 09/12/2018
42 574469 UTSW Msh6 1.000 R7404 G1 225.01 N 17 87975120 G T Het phenotype 09/13/2019
43 622156 UTSW Mylk3 0.269 Z1176 222 N 8 85365179 A T Het phenotype 01/23/2020
44 625940 UTSW Mylk3 0.269 Z1177 222 N 8 85365179 A T Het phenotype 01/23/2020
45 538078 UTSW Nsmce4a 0.929 R6451 G1 225.01 Y 7 130542749 G T Het 0.087 11/01/2018
46 616667 UTSW Olfr1240 0.159 R8007 G1 225.01 N 2 89440340 C T Het phenotype 01/23/2020
47 602629 UTSW Olfr585 0.060 RF003 G1 214.46 N 7 103098305 GTTAT GTTATTAT Het phenotype 12/04/2019
48 602689 UTSW Olfr585 0.060 RF004 G1 214.46 N 7 103098305 GTTAT GTTATTAT Het phenotype 12/04/2019
49 587065 UTSW Olfr869 0.073 R7585 G1 225.01 N 9 20129011 T C Het phenotype 10/24/2019
50 543456 UTSW Phc1 1.000 R6491 G1 225.01 Y 6 122334964 A G Het 0.087 phenotype 01/04/2019
51 600582 UTSW Serpinb6b 0.076 R7802 G1 225.01 N 13 32971596 C T Het 11/26/2019
52 538073 UTSW Sez6 0.000 R6475 G1 225.01 Y 11 77973844 A G Het phenotype 10/26/2018
53 544766 UTSW Slc7a1 1.000 R7007 G1 225.01 N 5 148352446 G A Het phenotype 05/13/2019
54 531220 UTSW Son 0.957 R6371 G1 225.01 Y 16 91674741 T C Het phenotype 08/06/2018
55 615890 UTSW Usp47 0.728 R7246 G1 124.01 Y 7 112115909 T A Het phenotype 01/08/2020
56 533159 UTSW Wdr26 0.866 R6334 G1 225.01 Y 1 181203206 T C Het phenotype 09/04/2018
57 192678 UTSW 1110017D15Rik 0.000 R1760 G1 225 Y 4 41507330 T A critical splice acceptor site Het probably null 0.949 phenotype 05/23/2014
58 602860 UTSW 1500015O10Rik 0.000 RF007 G1 214.46 N 1 43737192 TTCTGTA T critical splice acceptor site Het probably benign phenotype 12/04/2019
59 604985 UTSW 1500015O10Rik 0.000 RF045 G1 214.46 N 1 43737192 TTCTGTA T critical splice acceptor site Het probably benign phenotype 12/04/2019
60 192500 UTSW 1700001C02Rik 0.000 R1699 G1 225 N 5 30483866 A G critical splice acceptor site Het probably null 05/14/2014
61 538049 UTSW 1700011H14Rik 0.055 R6841 G1 225.01 Y 14 49243813 T C critical splice acceptor site Het probably null 10/18/2018
62 388197 UTSW 1700017D01Rik 0.085 R5099 G1 225 Y 19 11112461 T C critical splice acceptor site Het probably null 0.976 06/06/2016
63 478683 UTSW 1700019A02Rik 0.170 R6018 G1 225.01 N 1 53163246 C T critical splice acceptor site Het probably null 06/26/2017
64 190952 UTSW 1700023F06Rik 0.053 R1715 G1 169 N 11 103199824 T C critical splice acceptor site Het probably null 05/14/2014
65 409841 APN 1700029H14Rik 0.000 IGL03069 8 13557704 T G critical splice acceptor site Het probably null 08/02/2016
66 39342 UTSW 1700067P10Rik 0.056 R0445 G1 136 Y 17 48090022 A C critical splice acceptor site Het probably null 0.976 05/23/2013
67 626508 UTSW 1700093K21Rik 0.073 Z1177 225.01 N 11 23518144 T A critical splice acceptor site Het probably null phenotype 01/23/2020
68 379571 UTSW 2010111I01Rik 0.117 R4911 G1 225 Y 13 63170939 A T critical splice acceptor site Het probably null 0.947 phenotype 04/15/2016
69 26543 UTSW 2010315B03Rik 0.079 P4748 222 N 712 9 124295159 T C critical splice acceptor site Het probably benign 04/16/2013
70 60600 UTSW 2010315B03Rik 0.079 R0090 G1 213 N 9 124295159 T C critical splice acceptor site Het probably benign 07/24/2013
71 60571 UTSW 2010315B03Rik 0.079 R0122 G1 222 N 9 124295159 T C critical splice acceptor site Het probably benign 07/24/2013
72 22264 UTSW 2010315B03Rik 0.079 R0140 G1 222 N 9 124295159 T C critical splice acceptor site Het probably benign 04/16/2013
73 500098 UTSW 2010315B03Rik 0.079 R0164 G1 222 N 9 124295159 T C critical splice acceptor site Het probably benign 12/01/2017
74 31421 UTSW 2010315B03Rik 0.079 R0388 G1 222 N 9 124295159 T C critical splice acceptor site Het probably benign 04/24/2013
75 76984 UTSW 2010315B03Rik 0.079 R0775 G1 222 N 9 124295159 T C critical splice acceptor site Het probably benign 10/16/2013
76 76493 UTSW 2010315B03Rik 0.079 R0798 G1 222 N 9 124295159 T C critical splice acceptor site Het probably benign 10/16/2013
77 89620 APN 2300002M23Rik 0.119 IGL01527 G1 17 35567833 G T critical splice acceptor site Het probably null phenotype 12/03/2013
78 406142 UTSW 2310022A10Rik 0.190 R4806 G1 225 Y 7 27565645 A G critical splice acceptor site Het probably null 0.950 07/28/2016
79 559734 UTSW 2700049A03Rik 1.000 R7193 G1 225.01 Y 12 71219189 A G critical splice acceptor site Het probably null phenotype 06/26/2019
80 180063 APN 2700062C07Rik 0.833 IGL01919 G1 18 24475523 A G critical splice acceptor site Het probably null 05/07/2014
81 208042 UTSW 4430402I18Rik 0.126 R1850 G1 225 Y 19 28939171 T C critical splice acceptor site Het probably null 0.950 06/23/2014
82 462735 UTSW 4833423E24Rik 0.087 R5765 G1 225 Y 2 85484194 T G critical splice acceptor site Het probably null 0.976 03/01/2017
83 278029 APN 4921507P07Rik 0.065 IGL00852 G1 6 50589184 T A critical splice acceptor site Het probably null 04/16/2015
84 382658 UTSW 4921507P07Rik 0.065 R4976 G1 225 N 6 50589184 T A critical splice acceptor site Het probably null 04/27/2016
85 318775 UTSW 4921524L21Rik 0.099 R4201 G1 225 N 18 6623952 A G critical splice acceptor site Het probably null 06/10/2015
86 370200 UTSW 4930430A15Rik 0.057 R4821 G1 225 Y 2 111204145 T C critical splice acceptor site Het probably null 0.949 02/04/2016
87 507928 UTSW 4930452B06Rik 0.079 R6280 G1 225.01 Y 14 8473414 T G critical splice acceptor site Het probably null 0.949 03/15/2018
88 434933 UTSW 4930467E23Rik R5538 G1 225 N 8 19749414 A C critical splice acceptor site Het probably null 10/24/2016
89 482208 UTSW 4930579C12Rik 0.094 R5454 G1 225 Y 9 89168988 T C critical splice acceptor site Het noncoding transcript 07/11/2017
90 511096 UTSW 4932438A13Rik 1.000 FR4340 217.47 N 3 37050752 TATTATTAT TATTATTATTATTATCATTATTAT critical splice acceptor site Het probably benign phenotype 04/05/2018
91 511596 UTSW 4932438A13Rik 1.000 FR4737 217.47 N 3 37050754 TTATTAT TTATTATTATTATTACTATTAT critical splice acceptor site Het probably benign phenotype 04/05/2018
92 53494 APN 4932438A13Rik 1.000 IGL01019 G1 3 37006984 G T critical splice acceptor site Het probably null phenotype 06/28/2013
93 212811 UTSW 4932438A13Rik 1.000 R1919 G1 225 N 3 37006983 A G critical splice acceptor site Het probably null phenotype 07/14/2014
94 532627 UTSW 4932438A13Rik 1.000 R6792 G1 225.01 Y 3 37011566 A G critical splice acceptor site Het probably null phenotype 08/29/2018
95 596970 UTSW 4932438A13Rik 1.000 R7748 G1 225.01 N 3 36959335 A G critical splice acceptor site Het probably null phenotype 11/26/2019
96 603314 UTSW 4932438A13Rik 1.000 RF013 G1 217.47 N 3 37050757 TTAT TTATTATTATTATTAGTAT critical splice acceptor site Het probably benign phenotype 12/04/2019
97 603455 UTSW 4932438A13Rik 1.000 RF015 G1 214.46 N 3 37050748 TTATTATTATTAT TTATTATTATTATTAGTATTATTATTAT critical splice acceptor site Het probably benign phenotype 12/04/2019
98 603867 UTSW 4932438A13Rik 1.000 RF021 G1 217.73 N 3 37050748 TTATTATTATTAT TTATTATTATTATTAATATTATTATTAT critical splice acceptor site Het probably benign phenotype 12/04/2019
99 603979 UTSW 4932438A13Rik 1.000 RF023 G1 217.47 N 3 37050760 T TTATTATTATTATTAG critical splice acceptor site Het probably benign phenotype 12/04/2019
100 604479 UTSW 4932438A13Rik 1.000 RF034 G1 217.47 N 3 37050760 T TTATTATGATTATTAC critical splice acceptor site Het probably benign phenotype 12/04/2019
[records 1 to 100 of 500473] next >> last >|