Incidental Mutations

458,047 incidental mutations are currently displayed, and affect 22,320 genes.
72,103 are Possibly Damaging.
167,639 are Probably Damaging.
159,368 are Probably Benign.
48,414 are Probably Null.
18,934 create premature stop codons.
12,950 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 458047] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 543419 UTSW Abcc12 0.067 R6518 G1 225.01 Y 8 86509089 A G Het phenotype 11/29/2018
2 578164 UTSW App 0.728 R7456 G1 225.01 N 16 85173560 G A Het phenotype 10/07/2019
3 559285 UTSW Arid1a 1.000 R7186 G1 107.47 N 4 133753233 TGCCGCCGCCGCCGCCGCCGCCG TGCCGCCGCCGCCGCCGCCG Het phenotype 06/26/2019
4 565277 UTSW Atp9a 0.000 R7271 G1 225.01 N 2 168734127 G A Het 06/26/2019
5 531241 UTSW Ccdc171 0.356 PIT4131001 G1 50 Y 4 83661709 C T Het phenotype 08/10/2018
6 540722 UTSW Cmtm1 0.169 R6821 G1 214.46 N 8 104309702 TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG Het 11/16/2018
7 540724 UTSW Cmtm1 0.169 R6822 G1 168.47 N 8 104309702 TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG Het 11/16/2018
8 548434 UTSW Decr1 0.659 R7064 G1 225.01 N 4 15945392 C A Het phenotype 05/13/2019
9 531244 UTSW Efcab5 0.089 PIT4131001 G1 50 Y 11 77137691 C T Het 08/10/2018
10 535642 UTSW Eml5 0.269 R6375 G1 225.01 Y 12 98798868 T C Het 0.066 09/21/2018
11 573387 UTSW Ephx2 0.219 R7390 G1 166.01 N 14 66110455 G A Het phenotype 09/13/2019
12 543461 UTSW Espn 0.413 R6551 G1 225.01 Y 4 152128766 T C Het phenotype 01/04/2019
13 532071 UTSW Fam129b 0.170 R6769 G1 143.01 N 2 32895654 C T Het 08/29/2018
14 540699 UTSW Fbxo44 0.000 R6498 G1 150.01 Y 4 148154425 C T Het phenotype 11/09/2018
15 539760 UTSW Fkbp2 R6923 G1 225.01 N 19 6979169 A G Het phenotype 11/06/2018
16 548491 UTSW Frmd4a 0.243 R7065 G1 225.01 N 2 4566112 G A Het phenotype 05/13/2019
17 531250 UTSW Gbp11 0.056 R6336 G1 225.01 Y 5 105325489 A G Het 08/17/2018
18 18413 UTSW Gm10573 R0058 G1 Y 4 121920736 G A Het 03/25/2013
19 102937 APN Gm12588 IGL01655 G1 11 121907951 T A Het 01/21/2014
20 285860 APN Gm12588 IGL02234 11 121908325 T A Het 04/16/2015
21 583184 UTSW Gm13089 0.063 R7529 G1 200.01 N 4 143702674 T C Het 10/17/2019
22 292899 APN Gm14178 IGL02426 11 99747515 T C Het 04/16/2015
23 296237 APN Gm14179 IGL02504 11 99743177 A T Het 04/16/2015
24 297832 APN Gm14179 IGL02546 11 99743193 A T Het 04/16/2015
25 17067 UTSW Gm19618 R0066 G1 Y 6 87714245 A T Het 01/20/2013
26 16283 UTSW Gm19685 R0060 G1 Y 17 60768423 T C Het 01/20/2013
27 16229 UTSW Gm19993 R0053 G1 Y 1 19835048 A G Het 01/08/2013
28 531238 UTSW Gm32647 R6136 G1 216.01 Y 7 94475732 C T Het 0.056 08/07/2018
29 531239 UTSW Gm45704 R6144 G1 172.01 Y 8 72784292 T A Het 08/07/2018
30 111 UTSW Gm8251 0.112 D3080 Y grasshopper 1 44067335 C A Het 03/11/2010
31 292284 APN Gm9631 IGL02411 11 121943652 G A Het 04/16/2015
32 292474 APN Gm9631 IGL02417 11 121943652 G A Het 04/16/2015
33 292569 APN Gm9631 IGL02419 11 121943652 G A Het 04/16/2015
34 292613 APN Gm9631 IGL02420 11 121943652 G A Het 04/16/2015
35 18 UTSW Gm9943 A9681 G3 Y atchoum 17 16014992 T A Het 11/10/2009
36 539380 UTSW Hps1 0.188 R6916 G1 120.47 N 19 42766725 ATCCTCCTCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC Het phenotype 11/06/2018
37 535653 UTSW Lgals4 0.000 R6431 G1 225.01 Y 7 28840692 G T Het phenotype 09/27/2018
38 540707 UTSW Maml3 0.000 R6885 G1 109.47 N 3 51697579 TCTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGCTGTTGCTGCTGCTGC TCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGCTGTTGCTGCTGCTGC Het phenotype 11/16/2018
39 535566 UTSW Mbd1 0.000 R6861 G1 217.47 N 18 74273574 GTCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGC GTCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGC Het phenotype 09/12/2018
40 574469 UTSW Msh6 1.000 R7404 G1 225.01 N 17 87975120 G T Het phenotype 09/13/2019
41 538078 UTSW Nsmce4a 0.888 R6451 G1 225.01 Y 7 130542749 G T Het 0.077 11/01/2018
42 543456 UTSW Phc1 1.000 R6491 G1 225.01 Y 6 122334964 A G Het 0.094 phenotype 01/04/2019
43 538073 UTSW Sez6 0.350 R6475 G1 225.01 Y 11 77973844 A G Het phenotype 10/26/2018
44 544766 UTSW Slc7a1 1.000 R7007 G1 225.01 N 5 148352446 G A Het phenotype 05/13/2019
45 531220 UTSW Son 0.955 R6371 G1 225.01 Y 16 91674741 T C Het phenotype 08/06/2018
46 540715 UTSW Was 0.207 R6818 G1 117.47 N X 8086211 GCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTC GCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTC Het phenotype 11/16/2018
47 533159 UTSW Wdr26 0.808 R6334 G1 225.01 Y 1 181203206 T C Het phenotype 09/04/2018
48 192678 UTSW 1110017D15Rik 0.000 R1760 G1 225 Y 4 41507330 T A critical splice acceptor site Het probably null 0.542 phenotype 05/23/2014
49 192500 UTSW 1700001C02Rik 0.000 R1699 G1 225 N 5 30483866 A G critical splice acceptor site Het probably null 05/14/2014
50 538049 UTSW 1700011H14Rik 0.058 R6841 G1 225.01 Y 14 49243813 T C critical splice acceptor site Het probably null 10/18/2018
51 388197 UTSW 1700017D01Rik 0.079 R5099 G1 225 Y 19 11112461 T C critical splice acceptor site Het probably null 0.650 06/06/2016
52 478683 UTSW 1700019A02Rik 0.133 R6018 G1 225.01 N 1 53163246 C T critical splice acceptor site Het probably null 06/26/2017
53 190952 UTSW 1700023F06Rik 0.052 R1715 G1 169 N 11 103199824 T C critical splice acceptor site Het probably null 05/14/2014
54 409841 APN 1700029H14Rik 0.000 IGL03069 8 13557704 T G critical splice acceptor site Het probably null 08/02/2016
55 39342 UTSW 1700067P10Rik 0.057 R0445 G1 136 Y 17 48090022 A C critical splice acceptor site Het probably null 0.600 05/23/2013
56 379571 UTSW 2010111I01Rik 0.111 R4911 G1 225 Y 13 63170939 A T critical splice acceptor site Het probably null 0.492 phenotype 04/15/2016
57 26543 UTSW 2010315B03Rik 0.068 P4748 222 N 712 9 124295159 T C critical splice acceptor site Het probably benign 04/16/2013
58 60600 UTSW 2010315B03Rik 0.068 R0090 G1 213 N 9 124295159 T C critical splice acceptor site Het probably benign 07/24/2013
59 60571 UTSW 2010315B03Rik 0.068 R0122 G1 222 N 9 124295159 T C critical splice acceptor site Het probably benign 07/24/2013
60 22264 UTSW 2010315B03Rik 0.068 R0140 G1 222 N 9 124295159 T C critical splice acceptor site Het probably benign 04/16/2013
61 500098 UTSW 2010315B03Rik 0.068 R0164 G1 222 N 9 124295159 T C critical splice acceptor site Het probably benign 12/01/2017
62 31421 UTSW 2010315B03Rik 0.068 R0388 G1 222 N 9 124295159 T C critical splice acceptor site Het probably benign 04/24/2013
63 76984 UTSW 2010315B03Rik 0.068 R0775 G1 222 N 9 124295159 T C critical splice acceptor site Het probably benign 10/16/2013
64 76493 UTSW 2010315B03Rik 0.068 R0798 G1 222 N 9 124295159 T C critical splice acceptor site Het probably benign 10/16/2013
65 89620 APN 2300002M23Rik 0.107 IGL01527 G1 17 35567833 G T critical splice acceptor site Het probably null phenotype 12/03/2013
66 406142 UTSW 2310022A10Rik 0.206 R4806 G1 225 Y 7 27565645 A G critical splice acceptor site Het probably null 0.486 07/28/2016
67 559734 UTSW 2700049A03Rik 1.000 R7193 G1 225.01 Y 12 71219189 A G critical splice acceptor site Het probably null phenotype 06/26/2019
68 180063 APN 2700062C07Rik 0.854 IGL01919 G1 18 24475523 A G critical splice acceptor site Het probably null 05/07/2014
69 208042 UTSW 4430402I18Rik 0.080 R1850 G1 225 Y 19 28939171 T C critical splice acceptor site Het probably null 0.486 06/23/2014
70 462735 UTSW 4833423E24Rik 0.093 R5765 G1 225 Y 2 85484194 T G critical splice acceptor site Het probably null 0.644 03/01/2017
71 278029 APN 4921507P07Rik 0.059 IGL00852 G1 6 50589184 T A critical splice acceptor site Het probably null 04/16/2015
72 382658 UTSW 4921507P07Rik 0.059 R4976 G1 225 N 6 50589184 T A critical splice acceptor site Het probably null 04/27/2016
73 318775 UTSW 4921524L21Rik 0.077 R4201 G1 225 N 18 6623952 A G critical splice acceptor site Het probably null 06/10/2015
74 370200 UTSW 4930430A15Rik 0.057 R4821 G1 225 Y 2 111204145 T C critical splice acceptor site Het probably null 0.476 02/04/2016
75 507928 UTSW 4930452B06Rik 0.069 R6280 G1 225.01 Y 14 8473414 T G critical splice acceptor site Het probably null 0.550 03/15/2018
76 434933 UTSW 4930467E23Rik R5538 G1 225 N 8 19749414 A C critical splice acceptor site Het probably null 10/24/2016
77 482208 UTSW 4930579C12Rik 0.074 R5454 G1 225 Y 9 89168988 T C critical splice acceptor site Het noncoding transcript 07/11/2017
78 511096 UTSW 4932438A13Rik 1.000 FR4340 217.47 N 3 37050752 TATTATTAT TATTATTATTATTATCATTATTAT critical splice acceptor site Het probably benign phenotype 04/05/2018
79 511596 UTSW 4932438A13Rik 1.000 FR4737 217.47 N 3 37050754 TTATTAT TTATTATTATTATTACTATTAT critical splice acceptor site Het probably benign phenotype 04/05/2018
80 53494 APN 4932438A13Rik 1.000 IGL01019 G1 3 37006984 G T critical splice acceptor site Het probably null phenotype 06/28/2013
81 212811 UTSW 4932438A13Rik 1.000 R1919 G1 225 N 3 37006983 A G critical splice acceptor site Het probably null phenotype 07/14/2014
82 532627 UTSW 4932438A13Rik 1.000 R6792 G1 225.01 Y 3 37011566 A G critical splice acceptor site Het probably null phenotype 08/29/2018
83 57694 UTSW 5430403G16Rik 0.065 R0628 G1 208 Y 5 109678576 T C critical splice acceptor site Het probably null 0.520 07/11/2013
84 241496 UTSW 5430419D17Rik 0.000 R2221 G1 225 Y 7 131247457 A T critical splice acceptor site Het probably null 0.612 10/15/2014
85 241616 UTSW 5430419D17Rik 0.000 R2223 G1 225 Y 7 131247457 A T critical splice acceptor site Het probably null 0.612 10/15/2014
86 249756 UTSW 5830473C10Rik 0.064 R2440 G1 225 N 5 90572689 A G critical splice acceptor site Het probably null 11/12/2014
87 376254 UTSW 9930111J21Rik1 0.072 R4867 G1 225 N 11 48948548 T A critical splice acceptor site Het probably null 03/17/2016
88 420239 APN A2m 0.000 IGL03369 6 121676903 G A critical splice acceptor site Het probably null phenotype 08/02/2016
89 436215 UTSW A2ml1 0.000 R5532 G1 225 N 6 128553330 T A critical splice acceptor site Het probably null 10/24/2016
90 166432 UTSW A430105I19Rik 0.000 R1529 G1 225 N 2 118761760 T A critical splice acceptor site Het probably null 04/13/2014
91 565276 UTSW A430105I19Rik 0.000 R7271 G1 225.01 Y 2 118760683 T A critical splice acceptor site Het probably null 0.610 06/26/2019
92 391994 UTSW A530016L24Rik 0.017 IGL02835 G1 153 Y 12 112494986 A C critical splice acceptor site Het probably null 0.644 06/08/2016
93 564038 UTSW A730017C20Rik 0.000 R7252 G1 225.01 Y 18 59066908 A G critical splice acceptor site Het probably null 06/26/2019
94 345326 UTSW A830018L16Rik 0.065 R4598 G1 225 N 1 11747964 G A critical splice acceptor site Het probably null phenotype 09/25/2015
95 479514 UTSW A830018L16Rik 0.065 R6007 G1 225.01 Y 1 11511916 A G critical splice acceptor site Het probably null 0.522 phenotype 06/26/2017
96 302040 APN Aadacl4 0.063 IGL02648 4 144617822 A T critical splice acceptor site Het probably null 04/16/2015
97 102103 UTSW Aak1 0.433 R1141 G1 149 N 6 86965476 G A critical splice acceptor site Het probably null phenotype 01/15/2014
98 479868 UTSW Aanat 0.067 R6013 G1 225.01 Y 11 116596124 A T critical splice acceptor site Het probably null 0.458 phenotype 06/26/2017
99 204589 UTSW Aass 0.000 R1818 G1 225 N 6 23075858 T A critical splice acceptor site Het probably null phenotype 06/23/2014
100 12430 APN Abca12 1.000 IGL00813 G1 1 71353762 C A critical splice acceptor site Het probably null phenotype 12/06/2012
[records 1 to 100 of 458047] next >> last >|