Incidental Mutations

468,083 incidental mutations are currently displayed, and affect 22,326 genes.
73,743 are Possibly Damaging.
171,086 are Probably Damaging.
162,804 are Probably Benign.
49,366 are Probably Null.
19,380 create premature stop codons.
13,243 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 468083] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 543419 UTSW Abcc12 0.073 R6518 G1 225.01 Y 8 86509089 A G Het phenotype 11/29/2018
2 578164 UTSW App 0.605 R7456 G1 225.01 N 16 85173560 G A Het phenotype 10/07/2019
3 559285 UTSW Arid1a 1.000 R7186 G1 107.47 N 4 133753233 TGCCGCCGCCGCCGCCGCCGCCG TGCCGCCGCCGCCGCCGCCG Het phenotype 06/26/2019
4 565277 UTSW Atp9a 0.000 R7271 G1 225.01 N 2 168734127 G A Het 06/26/2019
5 531241 UTSW Ccdc171 0.356 PIT4131001 G1 50 Y 4 83661709 C T Het phenotype 08/10/2018
6 540722 UTSW Cmtm1 0.155 R6821 G1 214.46 N 8 104309702 TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG Het 11/16/2018
7 540724 UTSW Cmtm1 0.155 R6822 G1 168.47 N 8 104309702 TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG Het 11/16/2018
8 548434 UTSW Decr1 0.485 R7064 G1 225.01 N 4 15945392 C A Het phenotype 05/13/2019
9 531244 UTSW Efcab5 0.140 PIT4131001 G1 50 Y 11 77137691 C T Het 08/10/2018
10 535642 UTSW Eml5 0.355 R6375 G1 225.01 Y 12 98798868 T C Het 0.087 09/21/2018
11 573387 UTSW Ephx2 0.138 R7390 G1 166.01 N 14 66110455 G A Het phenotype 09/13/2019
12 543461 UTSW Espn 0.317 R6551 G1 225.01 Y 4 152128766 T C Het phenotype 01/04/2019
13 532071 UTSW Fam129b 0.199 R6769 G1 143.01 N 2 32895654 C T Het 08/29/2018
14 540699 UTSW Fbxo44 0.000 R6498 G1 150.01 Y 4 148154425 C T Het phenotype 11/09/2018
15 539760 UTSW Fkbp2 R6923 G1 225.01 N 19 6979169 A G Het phenotype 11/06/2018
16 548491 UTSW Frmd4a 0.203 R7065 G1 225.01 N 2 4566112 G A Het phenotype 05/13/2019
17 531250 UTSW Gbp11 0.054 R6336 G1 225.01 Y 5 105325489 A G Het 08/17/2018
18 591850 UTSW Gckr 0.000 R7665 G1 225.01 N 5 31297555 T C Het phenotype 11/12/2019
19 18413 UTSW Gm10573 R0058 G1 Y 4 121920736 G A Het 03/25/2013
20 102937 APN Gm12588 IGL01655 G1 11 121907951 T A Het 01/21/2014
21 285860 APN Gm12588 IGL02234 11 121908325 T A Het 04/16/2015
22 583184 UTSW Gm13089 0.062 R7529 G1 200.01 N 4 143702674 T C Het 10/17/2019
23 292899 APN Gm14178 IGL02426 11 99747515 T C Het 04/16/2015
24 296237 APN Gm14179 IGL02504 11 99743177 A T Het 04/16/2015
25 297832 APN Gm14179 IGL02546 11 99743193 A T Het 04/16/2015
26 17067 UTSW Gm19618 R0066 G1 Y 6 87714245 A T Het 01/20/2013
27 16283 UTSW Gm19685 R0060 G1 Y 17 60768423 T C Het 01/20/2013
28 16229 UTSW Gm19993 R0053 G1 Y 1 19835048 A G Het 01/08/2013
29 531238 UTSW Gm32647 R6136 G1 216.01 Y 7 94475732 C T Het 0.087 08/07/2018
30 531239 UTSW Gm45704 R6144 G1 172.01 Y 8 72784292 T A Het 08/07/2018
31 111 UTSW Gm8251 0.078 D3080 Y grasshopper 1 44067335 C A Het 03/11/2010
32 292284 APN Gm9631 IGL02411 11 121943652 G A Het 04/16/2015
33 292474 APN Gm9631 IGL02417 11 121943652 G A Het 04/16/2015
34 292569 APN Gm9631 IGL02419 11 121943652 G A Het 04/16/2015
35 292613 APN Gm9631 IGL02420 11 121943652 G A Het 04/16/2015
36 18 UTSW Gm9943 A9681 G3 Y atchoum 17 16014992 T A Het 11/10/2009
37 539380 UTSW Hps1 0.205 R6916 G1 120.47 N 19 42766725 ATCCTCCTCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC Het phenotype 11/06/2018
38 535653 UTSW Lgals4 0.000 R6431 G1 225.01 Y 7 28840692 G T Het phenotype 09/27/2018
39 540707 UTSW Maml3 0.000 R6885 G1 109.47 N 3 51697579 TCTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGCTGTTGCTGCTGCTGC TCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGCTGTTGCTGCTGCTGC Het phenotype 11/16/2018
40 535566 UTSW Mbd1 0.000 R6861 G1 217.47 N 18 74273574 GTCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGC GTCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGC Het phenotype 09/12/2018
41 574469 UTSW Msh6 1.000 R7404 G1 225.01 N 17 87975120 G T Het phenotype 09/13/2019
42 538078 UTSW Nsmce4a 0.917 R6451 G1 225.01 Y 7 130542749 G T Het 0.087 11/01/2018
43 587065 UTSW Olfr869 0.075 R7585 G1 225.01 N 9 20129011 T C Het phenotype 10/24/2019
44 543456 UTSW Phc1 1.000 R6491 G1 225.01 Y 6 122334964 A G Het 0.087 phenotype 01/04/2019
45 538073 UTSW Sez6 0.323 R6475 G1 225.01 Y 11 77973844 A G Het phenotype 10/26/2018
46 544766 UTSW Slc7a1 1.000 R7007 G1 225.01 N 5 148352446 G A Het phenotype 05/13/2019
47 531220 UTSW Son 0.955 R6371 G1 225.01 Y 16 91674741 T C Het phenotype 08/06/2018
48 533159 UTSW Wdr26 0.855 R6334 G1 225.01 Y 1 181203206 T C Het phenotype 09/04/2018
49 192678 UTSW 1110017D15Rik 0.000 R1760 G1 225 Y 4 41507330 T A critical splice acceptor site Het probably null 0.949 phenotype 05/23/2014
50 192500 UTSW 1700001C02Rik 0.000 R1699 G1 225 N 5 30483866 A G critical splice acceptor site Het probably null 05/14/2014
51 538049 UTSW 1700011H14Rik 0.061 R6841 G1 225.01 Y 14 49243813 T C critical splice acceptor site Het probably null 10/18/2018
52 388197 UTSW 1700017D01Rik 0.066 R5099 G1 225 Y 19 11112461 T C critical splice acceptor site Het probably null 0.976 06/06/2016
53 478683 UTSW 1700019A02Rik 0.144 R6018 G1 225.01 N 1 53163246 C T critical splice acceptor site Het probably null 06/26/2017
54 190952 UTSW 1700023F06Rik 0.051 R1715 G1 169 N 11 103199824 T C critical splice acceptor site Het probably null 05/14/2014
55 409841 APN 1700029H14Rik 0.000 IGL03069 8 13557704 T G critical splice acceptor site Het probably null 08/02/2016
56 39342 UTSW 1700067P10Rik 0.059 R0445 G1 136 Y 17 48090022 A C critical splice acceptor site Het probably null 0.976 05/23/2013
57 379571 UTSW 2010111I01Rik 0.089 R4911 G1 225 Y 13 63170939 A T critical splice acceptor site Het probably null 0.947 phenotype 04/15/2016
58 26543 UTSW 2010315B03Rik 0.070 P4748 222 N 712 9 124295159 T C critical splice acceptor site Het probably benign 04/16/2013
59 60600 UTSW 2010315B03Rik 0.070 R0090 G1 213 N 9 124295159 T C critical splice acceptor site Het probably benign 07/24/2013
60 60571 UTSW 2010315B03Rik 0.070 R0122 G1 222 N 9 124295159 T C critical splice acceptor site Het probably benign 07/24/2013
61 22264 UTSW 2010315B03Rik 0.070 R0140 G1 222 N 9 124295159 T C critical splice acceptor site Het probably benign 04/16/2013
62 500098 UTSW 2010315B03Rik 0.070 R0164 G1 222 N 9 124295159 T C critical splice acceptor site Het probably benign 12/01/2017
63 31421 UTSW 2010315B03Rik 0.070 R0388 G1 222 N 9 124295159 T C critical splice acceptor site Het probably benign 04/24/2013
64 76984 UTSW 2010315B03Rik 0.070 R0775 G1 222 N 9 124295159 T C critical splice acceptor site Het probably benign 10/16/2013
65 76493 UTSW 2010315B03Rik 0.070 R0798 G1 222 N 9 124295159 T C critical splice acceptor site Het probably benign 10/16/2013
66 89620 APN 2300002M23Rik 0.112 IGL01527 G1 17 35567833 G T critical splice acceptor site Het probably null phenotype 12/03/2013
67 406142 UTSW 2310022A10Rik 0.204 R4806 G1 225 Y 7 27565645 A G critical splice acceptor site Het probably null 0.950 07/28/2016
68 559734 UTSW 2700049A03Rik 1.000 R7193 G1 225.01 Y 12 71219189 A G critical splice acceptor site Het probably null phenotype 06/26/2019
69 180063 APN 2700062C07Rik 0.781 IGL01919 G1 18 24475523 A G critical splice acceptor site Het probably null 05/07/2014
70 208042 UTSW 4430402I18Rik 0.077 R1850 G1 225 Y 19 28939171 T C critical splice acceptor site Het probably null 0.950 06/23/2014
71 462735 UTSW 4833423E24Rik 0.071 R5765 G1 225 Y 2 85484194 T G critical splice acceptor site Het probably null 0.976 03/01/2017
72 278029 APN 4921507P07Rik 0.066 IGL00852 G1 6 50589184 T A critical splice acceptor site Het probably null 04/16/2015
73 382658 UTSW 4921507P07Rik 0.066 R4976 G1 225 N 6 50589184 T A critical splice acceptor site Het probably null 04/27/2016
74 318775 UTSW 4921524L21Rik 0.078 R4201 G1 225 N 18 6623952 A G critical splice acceptor site Het probably null 06/10/2015
75 370200 UTSW 4930430A15Rik 0.061 R4821 G1 225 Y 2 111204145 T C critical splice acceptor site Het probably null 0.949 02/04/2016
76 507928 UTSW 4930452B06Rik 0.088 R6280 G1 225.01 Y 14 8473414 T G critical splice acceptor site Het probably null 0.949 03/15/2018
77 434933 UTSW 4930467E23Rik R5538 G1 225 N 8 19749414 A C critical splice acceptor site Het probably null 10/24/2016
78 482208 UTSW 4930579C12Rik 0.069 R5454 G1 225 Y 9 89168988 T C critical splice acceptor site Het noncoding transcript 07/11/2017
79 511096 UTSW 4932438A13Rik 1.000 FR4340 217.47 N 3 37050752 TATTATTAT TATTATTATTATTATCATTATTAT critical splice acceptor site Het probably benign phenotype 04/05/2018
80 511596 UTSW 4932438A13Rik 1.000 FR4737 217.47 N 3 37050754 TTATTAT TTATTATTATTATTACTATTAT critical splice acceptor site Het probably benign phenotype 04/05/2018
81 53494 APN 4932438A13Rik 1.000 IGL01019 G1 3 37006984 G T critical splice acceptor site Het probably null phenotype 06/28/2013
82 212811 UTSW 4932438A13Rik 1.000 R1919 G1 225 N 3 37006983 A G critical splice acceptor site Het probably null phenotype 07/14/2014
83 532627 UTSW 4932438A13Rik 1.000 R6792 G1 225.01 Y 3 37011566 A G critical splice acceptor site Het probably null phenotype 08/29/2018
84 57694 UTSW 5430403G16Rik 0.073 R0628 G1 208 Y 5 109678576 T C critical splice acceptor site Het probably null 0.825 07/11/2013
85 241496 UTSW 5430419D17Rik 0.000 R2221 G1 225 Y 7 131247457 A T critical splice acceptor site Het probably null 0.976 10/15/2014
86 241616 UTSW 5430419D17Rik 0.000 R2223 G1 225 Y 7 131247457 A T critical splice acceptor site Het probably null 0.976 10/15/2014
87 249756 UTSW 5830473C10Rik 0.078 R2440 G1 225 N 5 90572689 A G critical splice acceptor site Het probably null 11/12/2014
88 376254 UTSW 9930111J21Rik1 0.082 R4867 G1 225 N 11 48948548 T A critical splice acceptor site Het probably null 03/17/2016
89 420239 APN A2m 0.000 IGL03369 6 121676903 G A critical splice acceptor site Het probably null phenotype 08/02/2016
90 436215 UTSW A2ml1 0.000 R5532 G1 225 N 6 128553330 T A critical splice acceptor site Het probably null 10/24/2016
91 166432 UTSW A430105I19Rik 0.000 R1529 G1 225 N 2 118761760 T A critical splice acceptor site Het probably null 04/13/2014
92 565276 UTSW A430105I19Rik 0.000 R7271 G1 225.01 Y 2 118760683 T A critical splice acceptor site Het probably null 0.949 06/26/2019
93 391994 UTSW A530016L24Rik 0.017 IGL02835 G1 153 Y 12 112494986 A C critical splice acceptor site Het probably null 0.976 06/08/2016
94 564038 UTSW A730017C20Rik 0.000 R7252 G1 225.01 Y 18 59066908 A G critical splice acceptor site Het probably null 0.976 06/26/2019
95 345326 UTSW A830018L16Rik 0.062 R4598 G1 225 N 1 11747964 G A critical splice acceptor site Het probably null phenotype 09/25/2015
96 479514 UTSW A830018L16Rik 0.062 R6007 G1 225.01 Y 1 11511916 A G critical splice acceptor site Het probably null 0.949 phenotype 06/26/2017
97 588386 UTSW A930009A15Rik 0.110 R7607 G1 225.01 N 10 115581989 G A critical splice acceptor site Het probably null 10/24/2019
98 302040 APN Aadacl4 0.063 IGL02648 4 144617822 A T critical splice acceptor site Het probably null 04/16/2015
99 102103 UTSW Aak1 0.496 R1141 G1 149 N 6 86965476 G A critical splice acceptor site Het probably null phenotype 01/15/2014
100 479868 UTSW Aanat 0.074 R6013 G1 225.01 Y 11 116596124 A T critical splice acceptor site Het probably null 0.971 phenotype 06/26/2017
[records 1 to 100 of 468083] next >> last >|