Incidental Mutations

468,083 incidental mutations are currently displayed, and affect 22,326 genes.
73,743 are Possibly Damaging.
171,086 are Probably Damaging.
162,804 are Probably Benign.
49,366 are Probably Null.
19,380 create premature stop codons.
13,243 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 468083] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 586135 UTSW 1700003H04Rik 0.064 R7573 G1 225.01 N 3 124573268 I49F T A missense Het 10/24/2019
2 582560 UTSW 2310022A10Rik 0.204 R7519 G1 225.01 N 7 27574730 R132K G A missense Het 10/17/2019
3 570102 UTSW 4930438A08Rik 0.086 R7344 G1 225.01 Y 11 58291447 Y216S A C missense Het 09/13/2019
4 590863 UTSW 4930438A08Rik 0.086 R7651 G1 225.01 N 11 58293362 V302G T G missense Het 10/24/2019
5 561124 UTSW 4932438A13Rik 1.000 R7212 G1 225.01 Y 3 37048009 N1363K C A missense Het 0.087 phenotype 06/26/2019
6 562963 UTSW 4933402N22Rik R7238 G1 191.01 N 5 11920745 I127T T C missense Het 06/26/2019
7 561113 UTSW 9930021J03Rik 0.114 R7211 G1 225.01 Y 19 29786312 F121S A G missense Het 06/26/2019
8 558061 UTSW Abcb10 1.000 R7168 G1 225.01 Y 8 123966611 L318Q A T missense Het phenotype 06/26/2019
9 543419 UTSW Abcc12 0.073 R6518 G1 225.01 Y 8 86509089 A G Het phenotype 11/29/2018
10 568682 UTSW AC166344.1 R7135 G1 68.01 Y 14 43300788 F97I T A missense Het 09/11/2019
11 561733 UTSW Acan 1.000 R7220 G1 225.01 Y 7 79108148 N506S A G missense Het phenotype 06/26/2019
12 584055 UTSW Acsl5 0.000 R7543 G1 225.01 N 19 55278183 V59I G A missense Het phenotype 10/17/2019
13 570878 UTSW Adamts17 0.081 R7355 G1 225.01 Y 7 67075304 V160A T C missense Het phenotype 09/13/2019
14 576553 UTSW Adamts17 0.081 R7432 G1 225.01 N 7 67051917 K40E A G missense Het phenotype 10/07/2019
15 594521 UTSW Adamtsl1 0.159 R7710 G1 225.01 N 4 86232573 E151K G A missense Het phenotype 11/12/2019
16 551390 UTSW Adamtsl3 0.000 R7109 G1 225.01 N 7 82611861 P29S C T missense Het phenotype 05/15/2019
17 561309 UTSW Adgrg5 0.000 R7214 G1 225.01 N 8 94934018 T95I C T missense Het phenotype 06/26/2019
18 593098 UTSW Adgrg5 0.000 R7686 G1 225.01 N 8 94937802 I347F A T missense Het phenotype 11/12/2019
19 554671 UTSW Adgrl2 1.000 PIT4382001 G1 225.01 N 3 148817298 L430P A G missense Het phenotype 06/07/2019
20 570333 UTSW Adgrl2 1.000 R7348 G1 225.01 Y 3 148817766 I274N A T missense Het 0.794 phenotype 09/13/2019
21 572780 UTSW Adgrl2 1.000 R7382 G1 225.01 Y 3 148817283 Q435P T G missense Het phenotype 09/13/2019
22 580147 UTSW Adgrl2 1.000 R7486 G1 225.01 N 3 148817694 V298A A G missense Het phenotype 10/07/2019
23 593321 UTSW Adgrl2 1.000 R7690 G1 225.01 N 3 148817298 L430P A G missense Het phenotype 11/12/2019
24 553830 UTSW Adk 1.000 R7146 G1 225.01 Y 14 21326614 P27H C A missense Het phenotype 05/15/2019
25 591134 UTSW Agbl1 0.000 R7655 G1 225.01 N 7 76409332 M237V A G missense Het phenotype 11/12/2019
26 591198 UTSW Agbl1 0.000 R7656 G1 225.01 N 7 76409332 M237V A G missense Het phenotype 11/12/2019
27 555381 UTSW Agl 0.206 PIT4445001 G1 225.01 N 3 116771460 M382V T C missense Het phenotype 06/07/2019
28 576049 UTSW Agl 0.206 R7426 G1 225.01 N 3 116758755 L510P A G missense Het phenotype 10/07/2019
29 584930 UTSW Agl 0.206 R7559 G1 225.01 N 3 116752115 D679G T C missense Het phenotype 10/17/2019
30 591254 UTSW Agl 0.206 R7657 G1 225.01 N 3 116779163 H148R T C missense Het phenotype 11/12/2019
31 594833 UTSW Agl 0.206 R7715 G1 225.01 N 3 116758256 R563Q C T missense Het phenotype 11/12/2019
32 556869 UTSW Ahnak2 0.063 PIT4810001 G1 225.01 N 12 112785594 D211V T A missense Het 06/07/2019
33 548980 UTSW Ahnak2 0.063 R7072 G1 225.01 Y 12 112788166 Q23L T A missense Het 05/15/2019
34 551581 UTSW Ahnak2 0.063 R7112 G1 131.01 N 12 112783119 A1036E G T missense Het 05/15/2019
35 565099 UTSW Ahnak2 0.063 R7268 G1 203.01 N 12 112780802 V70E A T missense Het 06/26/2019
36 565173 UTSW Ahnak2 0.063 R7269 G1 225.01 N 12 112780802 V70E A T missense Het 06/26/2019
37 565251 UTSW Ahnak2 0.063 R7270 G1 216.01 N 12 112780802 V70E A T missense Het 06/26/2019
38 565315 UTSW Ahnak2 0.063 R7271 G1 225.01 N 12 112780802 V70E A T missense Het 06/26/2019
39 577185 UTSW Ahnak2 0.063 R7444 G1 168.01 N 12 112781208 Q1673L T A missense Het 10/07/2019
40 577500 UTSW Ahnak2 0.063 R7448 G1 222.01 N 12 112782502 K1242E T C missense Het 10/07/2019
41 580363 UTSW Ahnak2 0.063 R7488 G1 225.01 N 12 112785021 I402T A G missense Het 10/07/2019
42 585060 UTSW Ahnak2 0.063 R7560 G1 225.01 N 12 112779674 D446A T G missense Het 10/17/2019
43 588623 UTSW Ahnak2 0.063 R7611 G1 225.01 N 12 112788129 D35E G T missense Het 10/24/2019
44 566021 UTSW Ak9 0.239 R7286 G1 225.01 N 10 41407371 I1273L A T missense Het phenotype 06/26/2019
45 579615 UTSW Ak9 0.239 R7478 G1 225.01 N 10 41389091 F948S T C missense Het phenotype 10/07/2019
46 593791 UTSW Ak9 0.239 R7698 G1 225.01 N 10 41348076 L495S T C missense Het phenotype 11/12/2019
47 374093 UTSW Akap11 0.000 R4857 G1 190 Y 14 78498860 D1830G T C missense Het 0.297 phenotype 03/01/2016
48 547457 UTSW Akap11 0.000 R7048 G1 225.01 Y 14 78512514 Q811L T A missense Het 0.147 phenotype 05/13/2019
49 553905 UTSW Akap11 0.000 R7147 G1 225.01 N 14 78511465 S1161P A G missense Het phenotype 05/15/2019
50 579296 UTSW Akap11 0.000 R7473 G1 225.01 N 14 78513888 V353E A T missense Het phenotype 10/07/2019
51 581640 UTSW Akap11 0.000 R7503 G1 225.01 N 14 78512001 D982G T C missense Het phenotype 10/17/2019
52 583977 UTSW Akap11 0.000 R7542 G1 225.01 N 14 78510292 S1552T A T missense Het phenotype 10/17/2019
53 589021 UTSW Akap11 0.000 R7618 G1 225.01 N 14 78498860 D1830G T C missense Het 0.297 phenotype 10/24/2019
54 592667 UTSW Akap11 0.000 R7679 G1 225.01 N 14 78514816 Y206D A C missense Het phenotype 11/12/2019
55 595888 UTSW Alpk1 0.000 R7732 G1 225.01 N 3 127684392 M69V T C missense Het phenotype 11/12/2019
56 574298 UTSW Amdhd2 0.394 R7402 G1 225.01 N 17 24161683 S96P A G missense Het 09/13/2019
57 555969 UTSW Ank3 0.855 PIT4495001 G1 222.01 N 10 69993072 H2524N C A missense Het phenotype 06/07/2019
58 552757 UTSW Ank3 0.855 R7132 G1 225.01 N 10 69989914 A1471V C T missense Het phenotype 05/15/2019
59 558280 UTSW Ank3 0.855 R7171 G1 225.01 Y 10 69992481 H2327Y C T missense Het 0.141 phenotype 06/26/2019
60 577238 UTSW Ank3 0.855 R7445 G1 225.01 N 10 69992124 T2208A A G missense Het phenotype 10/07/2019
61 580995 UTSW Ank3 0.855 R7494 G1 225.01 N 10 69988926 Y1142H T C missense Het phenotype 10/17/2019
62 582162 UTSW Ank3 0.855 R7512 G1 225.01 N 10 69990861 K1787E A G missense Het phenotype 10/17/2019
63 586521 UTSW Ank3 0.855 R7577 G1 225.01 N 10 69992572 T2357I C T missense Het phenotype 10/24/2019
64 588554 UTSW Ank3 0.855 R7610 G1 225.01 N 10 69986422 N307I A T missense Het phenotype 10/24/2019
65 592317 UTSW Ank3 0.855 R7673 G1 225.01 N 10 69990501 I1667F A T missense Het phenotype 11/12/2019
66 549191 UTSW Ankhd1 0.000 R7075 G1 225.01 Y 18 36559989 V1A T C missense Het 05/15/2019
67 567280 UTSW Ankhd1 0.000 R7305 G1 225.01 N 18 36632205 D87G A G missense Het 06/26/2019
68 588893 UTSW Ankhd1 0.000 R7615 G1 225.01 N 18 36656773 Q466L A T missense Het 10/24/2019
69 572839 UTSW Ankrd2 0.000 R7382 G1 225.01 Y 19 42044972 G318C G T missense Het phenotype 09/13/2019
70 584814 UTSW Ankrd2 0.000 R7556 G1 225.01 N 19 42040400 D134G A G missense Het phenotype 10/17/2019
71 558731 UTSW Ankrd44 0.209 R7178 G1 225.01 Y 1 54649440 N212K A T missense Het 06/26/2019
72 581449 UTSW Ankrd44 0.209 R7501 G1 225.01 N 1 54649363 E238G T C missense Het 10/17/2019
73 560123 UTSW Ano7 0.000 R7199 G1 225.01 N 1 93402978 D54V A T missense Het phenotype 06/26/2019
74 578164 UTSW App 0.605 R7456 G1 225.01 N 16 85173560 G A Het phenotype 10/07/2019
75 566104 UTSW Arhgap32 0.000 R7287 G1 225.01 Y 9 32152697 D77G A G missense Het phenotype 06/26/2019
76 554609 UTSW Arhgef38 0.000 PIT4362001 G1 225.01 N 3 133160830 D182V T A missense Het 06/07/2019
77 585097 UTSW Arhgef38 0.000 R7561 G1 225.01 N 3 133160728 Q216R T C missense Het 10/17/2019
78 559285 UTSW Arid1a 1.000 R7186 G1 107.47 N 4 133753233 TGCCGCCGCCGCCGCCGCCGCCG TGCCGCCGCCGCCGCCGCCG Het phenotype 06/26/2019
79 576779 UTSW Atp13a4 0.000 R7438 G1 225.01 N 16 29441196 G607D C T missense Het 10/07/2019
80 580962 UTSW Atp13a4 0.000 R7493 G1 225.01 N 16 29471956 E225V T A missense Het 10/17/2019
81 594708 UTSW Atp13a4 0.000 R7712 G1 225.01 N 16 29459487 C298R A G missense Het 11/12/2019
82 555389 UTSW Atp8a1 0.000 PIT4445001 G1 149.01 N 5 67622660 V1145A A G missense Het phenotype 06/07/2019
83 561580 UTSW Atp8a1 0.000 R7218 G1 225.01 Y 5 67702981 D717V T A missense Het phenotype 06/26/2019
84 571540 UTSW Atp8a1 0.000 R7278 G1 225.01 Y 5 67624037 S1124P A G missense Het 0.115 phenotype 09/13/2019
85 583255 UTSW Atp8a1 0.000 R7530 G1 225.01 N 5 67745628 L535R A C missense Het phenotype 10/17/2019
86 587615 UTSW Atp8a1 0.000 R7594 G1 225.01 N 5 67651592 Y985C T C missense Het phenotype 10/24/2019
87 583403 UTSW Atp8b2 0.160 R7533 G1 225.01 N 3 89945524 L144F G A missense Het phenotype 10/17/2019
88 565277 UTSW Atp9a 0.000 R7271 G1 225.01 N 2 168734127 G A Het 06/26/2019
89 552872 UTSW Atp9b 0.147 R7133 G1 225.01 Y 18 80909656 V164A A G missense Het 05/15/2019
90 559460 UTSW Atp9b 0.147 R7188 G1 225.01 N 18 80917826 S57P A G missense Het 06/26/2019
91 573864 UTSW Atp9b 0.147 R7396 G1 225.01 N 18 80736842 I1092V T C missense Het 09/13/2019
92 576605 UTSW Atp9b 0.147 R7432 G1 225.01 N 18 80765841 V621A A G missense Het 10/07/2019
93 557139 UTSW Auts2 1.000 R7154 G1 225.01 Y 5 131451893 S255T A T missense Het phenotype 06/26/2019
94 551714 UTSW Axdnd1 0.114 R7115 G1 225.01 N 1 156380876 K267R T C missense Het phenotype 05/15/2019
95 579082 UTSW Axdnd1 0.114 R7470 G1 225.01 N 1 156376516 E393V T A missense Het phenotype 10/07/2019
96 580514 UTSW Bace2 0.083 R7653 G1 225.01 N 16 97436652 V38E T A missense Het phenotype 10/07/2019
97 551814 UTSW Baz2b 0.219 R7117 G1 225.01 Y 2 59912497 V13A A G missense Het phenotype 05/15/2019
98 552523 UTSW BC051019 0.123 R7129 G1 225.01 Y 7 109720618 S10G T C missense Het 05/15/2019
99 550784 UTSW BC067074 0.254 R7100 G1 225.01 Y 13 113318967 F516I T A missense Het 05/15/2019
100 551740 UTSW BC067074 0.254 R7115 G1 225.01 N 13 113320776 S1119A T G missense Het 05/15/2019
[records 1 to 100 of 468083] next >> last >|