Incidental Mutations

458,047 incidental mutations are currently displayed, and affect 22,320 genes.
72,103 are Possibly Damaging.
167,639 are Probably Damaging.
159,368 are Probably Benign.
48,414 are Probably Null.
18,934 create premature stop codons.
12,950 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 458047] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 582560 UTSW 2310022A10Rik 0.206 R7519 G1 225.01 N 7 27574730 R132K G A missense Het 10/17/2019
2 570102 UTSW 4930438A08Rik 0.071 R7344 G1 225.01 Y 11 58291447 Y216S A C missense Het 09/13/2019
3 561124 UTSW 4932438A13Rik 1.000 R7212 G1 225.01 Y 3 37048009 N1363K C A missense Het 0.062 phenotype 06/26/2019
4 562963 UTSW 4933402N22Rik R7238 G1 191.01 N 5 11920745 I127T T C missense Het 06/26/2019
5 561113 UTSW 9930021J03Rik 0.127 R7211 G1 225.01 Y 19 29786312 F121S A G missense Het 06/26/2019
6 558061 UTSW Abcb10 1.000 R7168 G1 225.01 Y 8 123966611 L318Q A T missense Het phenotype 06/26/2019
7 543419 UTSW Abcc12 0.067 R6518 G1 225.01 Y 8 86509089 A G Het phenotype 11/29/2018
8 568682 UTSW AC166344.1 R7135 G1 68.01 Y 14 43300788 F97I T A missense Het 09/11/2019
9 561733 UTSW Acan 1.000 R7220 G1 225.01 Y 7 79108148 N506S A G missense Het phenotype 06/26/2019
10 584055 UTSW Acsl5 0.000 R7543 G1 225.01 N 19 55278183 V59I G A missense Het phenotype 10/17/2019
11 570878 UTSW Adamts17 0.083 R7355 G1 225.01 N 7 67075304 V160A T C missense Het phenotype 09/13/2019
12 576553 UTSW Adamts17 0.083 R7432 G1 225.01 N 7 67051917 K40E A G missense Het phenotype 10/07/2019
13 551390 UTSW Adamtsl3 0.000 R7109 G1 225.01 N 7 82611861 P29S C T missense Het phenotype 05/15/2019
14 561309 UTSW Adgrg5 0.000 R7214 G1 225.01 N 8 94934018 T95I C T missense Het phenotype 06/26/2019
15 554671 UTSW Adgrl2 1.000 PIT4382001 G1 225.01 N 3 148817298 L430P A G missense Het phenotype 06/07/2019
16 570333 UTSW Adgrl2 1.000 R7348 G1 225.01 N 3 148817766 I274N A T missense Het phenotype 09/13/2019
17 572780 UTSW Adgrl2 1.000 R7382 G1 225.01 N 3 148817283 Q435P T G missense Het phenotype 09/13/2019
18 580147 UTSW Adgrl2 1.000 R7486 G1 225.01 N 3 148817694 V298A A G missense Het phenotype 10/07/2019
19 553830 UTSW Adk 1.000 R7146 G1 225.01 Y 14 21326614 P27H C A missense Het phenotype 05/15/2019
20 555381 UTSW Agl 0.178 PIT4445001 G1 225.01 N 3 116771460 M382V T C missense Het phenotype 06/07/2019
21 576049 UTSW Agl 0.178 R7426 G1 225.01 N 3 116758755 L510P A G missense Het phenotype 10/07/2019
22 584930 UTSW Agl 0.178 R7559 G1 225.01 N 3 116752115 D679G T C missense Het phenotype 10/17/2019
23 556869 UTSW Ahnak2 0.060 PIT4810001 G1 225.01 N 12 112785594 D211V T A missense Het 06/07/2019
24 548980 UTSW Ahnak2 0.060 R7072 G1 225.01 Y 12 112788166 Q23L T A missense Het 05/15/2019
25 551581 UTSW Ahnak2 0.060 R7112 G1 131.01 N 12 112783119 A1036E G T missense Het 05/15/2019
26 565099 UTSW Ahnak2 0.060 R7268 G1 203.01 N 12 112780802 V70E A T missense Het 06/26/2019
27 565173 UTSW Ahnak2 0.060 R7269 G1 225.01 N 12 112780802 V70E A T missense Het 06/26/2019
28 565251 UTSW Ahnak2 0.060 R7270 G1 216.01 N 12 112780802 V70E A T missense Het 06/26/2019
29 565315 UTSW Ahnak2 0.060 R7271 G1 225.01 N 12 112780802 V70E A T missense Het 06/26/2019
30 577185 UTSW Ahnak2 0.060 R7444 G1 168.01 N 12 112781208 Q1673L T A missense Het 10/07/2019
31 577500 UTSW Ahnak2 0.060 R7448 G1 222.01 N 12 112782502 K1242E T C missense Het 10/07/2019
32 580363 UTSW Ahnak2 0.060 R7488 G1 225.01 N 12 112785021 I402T A G missense Het 10/07/2019
33 585060 UTSW Ahnak2 0.060 R7560 G1 225.01 N 12 112779674 D446A T G missense Het 10/17/2019
34 566021 UTSW Ak9 0.193 R7286 G1 225.01 N 10 41407371 I1273L A T missense Het phenotype 06/26/2019
35 579615 UTSW Ak9 0.193 R7478 G1 225.01 N 10 41389091 F948S T C missense Het phenotype 10/07/2019
36 547457 UTSW Akap11 0.000 R7048 G1 225.01 Y 14 78512514 Q811L T A missense Het 0.074 phenotype 05/13/2019
37 553905 UTSW Akap11 0.000 R7147 G1 225.01 N 14 78511465 S1161P A G missense Het phenotype 05/15/2019
38 579296 UTSW Akap11 0.000 R7473 G1 225.01 N 14 78513888 V353E A T missense Het phenotype 10/07/2019
39 581640 UTSW Akap11 0.000 R7503 G1 225.01 N 14 78512001 D982G T C missense Het phenotype 10/17/2019
40 583977 UTSW Akap11 0.000 R7542 G1 225.01 N 14 78510292 S1552T A T missense Het phenotype 10/17/2019
41 574298 UTSW Amdhd2 0.496 R7402 G1 225.01 N 17 24161683 S96P A G missense Het 09/13/2019
42 555969 UTSW Ank3 0.843 PIT4495001 G1 222.01 N 10 69993072 H2524N C A missense Het phenotype 06/07/2019
43 552757 UTSW Ank3 0.843 R7132 G1 225.01 N 10 69989914 A1471V C T missense Het phenotype 05/15/2019
44 558280 UTSW Ank3 0.843 R7171 G1 225.01 Y 10 69992481 H2327Y C T missense Het 0.140 phenotype 06/26/2019
45 577238 UTSW Ank3 0.843 R7445 G1 225.01 N 10 69992124 T2208A A G missense Het phenotype 10/07/2019
46 580995 UTSW Ank3 0.843 R7494 G1 225.01 N 10 69988926 Y1142H T C missense Het phenotype 10/17/2019
47 582162 UTSW Ank3 0.843 R7512 G1 225.01 N 10 69990861 K1787E A G missense Het phenotype 10/17/2019
48 549191 UTSW Ankhd1 0.000 R7075 G1 225.01 Y 18 36559989 V1A T C missense Het 05/15/2019
49 567280 UTSW Ankhd1 0.000 R7305 G1 225.01 N 18 36632205 D87G A G missense Het 06/26/2019
50 572839 UTSW Ankrd2 0.000 R7382 G1 225.01 N 19 42044972 G318C G T missense Het phenotype 09/13/2019
51 584814 UTSW Ankrd2 0.000 R7556 G1 225.01 N 19 42040400 D134G A G missense Het phenotype 10/17/2019
52 558731 UTSW Ankrd44 0.320 R7178 G1 225.01 Y 1 54649440 N212K A T missense Het 06/26/2019
53 581449 UTSW Ankrd44 0.320 R7501 G1 225.01 N 1 54649363 E238G T C missense Het 10/17/2019
54 560123 UTSW Ano7 0.000 R7199 G1 225.01 N 1 93402978 D54V A T missense Het phenotype 06/26/2019
55 578164 UTSW App 0.728 R7456 G1 225.01 N 16 85173560 G A Het phenotype 10/07/2019
56 566104 UTSW Arhgap32 0.000 R7287 G1 225.01 Y 9 32152697 D77G A G missense Het phenotype 06/26/2019
57 554609 UTSW Arhgef38 0.000 PIT4362001 G1 225.01 N 3 133160830 D182V T A missense Het 06/07/2019
58 585097 UTSW Arhgef38 0.000 R7561 G1 225.01 N 3 133160728 Q216R T C missense Het 10/17/2019
59 559285 UTSW Arid1a 1.000 R7186 G1 107.47 N 4 133753233 TGCCGCCGCCGCCGCCGCCGCCG TGCCGCCGCCGCCGCCGCCG Het phenotype 06/26/2019
60 576779 UTSW Atp13a4 0.000 R7438 G1 225.01 N 16 29441196 G607D C T missense Het 10/07/2019
61 580962 UTSW Atp13a4 0.000 R7493 G1 225.01 N 16 29471956 E225V T A missense Het 10/17/2019
62 555389 UTSW Atp8a1 0.000 PIT4445001 G1 149.01 N 5 67622660 V1145A A G missense Het phenotype 06/07/2019
63 561580 UTSW Atp8a1 0.000 R7218 G1 225.01 Y 5 67702981 D717V T A missense Het phenotype 06/26/2019
64 571540 UTSW Atp8a1 0.000 R7278 G1 225.01 Y 5 67624037 S1124P A G missense Het phenotype 09/13/2019
65 583255 UTSW Atp8a1 0.000 R7530 G1 225.01 N 5 67745628 L535R A C missense Het phenotype 10/17/2019
66 583403 UTSW Atp8b2 0.147 R7533 G1 225.01 N 3 89945524 L144F G A missense Het phenotype 10/17/2019
67 565277 UTSW Atp9a 0.000 R7271 G1 225.01 N 2 168734127 G A Het 06/26/2019
68 552872 UTSW Atp9b 0.150 R7133 G1 225.01 Y 18 80909656 V164A A G missense Het 05/15/2019
69 559460 UTSW Atp9b 0.150 R7188 G1 225.01 N 18 80917826 S57P A G missense Het 06/26/2019
70 573864 UTSW Atp9b 0.150 R7396 G1 225.01 N 18 80736842 I1092V T C missense Het 09/13/2019
71 576605 UTSW Atp9b 0.150 R7432 G1 225.01 N 18 80765841 V621A A G missense Het 10/07/2019
72 557139 UTSW Auts2 1.000 R7154 G1 225.01 Y 5 131451893 S255T A T missense Het phenotype 06/26/2019
73 551714 UTSW Axdnd1 0.117 R7115 G1 225.01 N 1 156380876 K267R T C missense Het phenotype 05/15/2019
74 579082 UTSW Axdnd1 0.117 R7470 G1 225.01 N 1 156376516 E393V T A missense Het phenotype 10/07/2019
75 580514 UTSW Bace2 0.110 R7653 G1 225.01 N 16 97436652 V38E T A missense Het phenotype 10/07/2019
76 551814 UTSW Baz2b 0.226 R7117 G1 225.01 Y 2 59912497 V13A A G missense Het phenotype 05/15/2019
77 552523 UTSW BC051019 0.157 R7129 G1 225.01 Y 7 109720618 S10G T C missense Het 05/15/2019
78 550784 UTSW BC067074 0.238 R7100 G1 225.01 Y 13 113318967 F516I T A missense Het 05/15/2019
79 551740 UTSW BC067074 0.238 R7115 G1 225.01 N 13 113320776 S1119A T G missense Het 05/15/2019
80 554219 UTSW BC067074 0.238 R7152 G1 225.01 Y 13 113318850 F477L T C missense Het 05/15/2019
81 559880 UTSW BC067074 0.238 R7195 G1 225.01 N 13 113367929 D1864V A T missense Het 06/26/2019
82 561243 UTSW BC067074 0.238 R7213 G1 225.01 Y 13 113317941 F174I T A missense Het 0.055 06/26/2019
83 563869 UTSW BC067074 0.238 R7250 G1 225.01 N 13 113318815 I465R T G missense Het 06/26/2019
84 569887 UTSW BC067074 0.238 R7341 G1 225.01 N 13 113318172 G251C G T missense Het 09/13/2019
85 571135 UTSW BC067074 0.238 R7358 G1 225.01 N 13 113319967 D849G A G missense Het 09/13/2019
86 571223 UTSW BC067074 0.238 R7359 G1 225.01 N 13 113342430 S1503P T C missense Het 09/13/2019
87 573851 UTSW BC067074 0.238 R7396 G1 225.01 N 13 113318990 S523R T A missense Het 09/13/2019
88 564571 UTSW Boc 0.000 R7260 G1 225.01 Y 16 44490170 F796I A T missense Het phenotype 06/26/2019
89 578273 UTSW Boc 0.000 R7458 G1 225.01 N 16 44486756 E1034G T C missense Het phenotype 10/07/2019
90 572187 UTSW C2cd2 0.000 R7372 G1 128.01 N 16 97875380 C136S A T missense Het 09/13/2019
91 550006 UTSW C2cd3 1.000 R7088 G1 225.01 Y 7 100416181 T347A A G missense Het phenotype 05/15/2019
92 558493 UTSW C2cd3 1.000 R7174 G1 225.01 Y 7 100432198 S1016P T C missense Het phenotype 06/26/2019
93 563204 UTSW C2cd3 1.000 R7241 G1 225.01 N 7 100407050 K177T A C missense Het phenotype 06/26/2019
94 569438 UTSW C2cd3 1.000 R7335 G1 225.01 N 7 100422603 V629A T C missense Het phenotype 09/13/2019
95 571029 UTSW C2cd3 1.000 R7357 G1 225.01 Y 7 100430103 N838S A G missense Het phenotype 09/13/2019
96 580925 UTSW C2cd3 1.000 R7493 G1 225.01 N 7 100427226 I797V A G missense Het phenotype 10/17/2019
97 585514 UTSW C2cd3 1.000 R7567 G1 225.01 N 7 100430815 V936A T C missense Het phenotype 10/17/2019
98 579831 UTSW C6 0.138 R7481 G1 225.01 N 15 4814875 I926M A G missense Het phenotype 10/07/2019
99 580507 UTSW C6 0.138 R7653 G1 225.01 N 15 4814762 S889T T A missense Het phenotype 10/07/2019
100 564881 UTSW Cabin1 1.000 R7265 G1 225.01 N 10 75721423 N300S T C missense Het phenotype 06/26/2019
[records 1 to 100 of 458047] next >> last >|