Incidental Mutations

534,649 incidental mutations are currently displayed, and affect 22,493 genes.
83,841 are Possibly Damaging.
192,751 are Probably Damaging.
186,776 are Probably Benign.
56,636 are Probably Null.
22,107 create premature stop codons.
15,334 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 534649] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 668201 UTSW Ins1 0.466 R8491 G1 71.01 Y 19 52264370 A G start gained Het probably benign 0.085 phenotype 04/21/2021
2 668200 UTSW Zfp958 0.079 R8491 G1 57.01 Y 8 4626215 R61I G T missense Het probably damaging 0.992 04/21/2021
3 668199 UTSW Cyp4a12a 0.076 R8491 G1 225.01 Y 4 115301453 C A splice site Het probably null 04/21/2021
4 668198 UTSW Fgf1 0.000 R8478 G1 217.01 Y 18 38854891 T C splice site 3655 bp Het probably null phenotype 04/21/2021
5 668197 UTSW Gm35339 0.139 R8478 G1 225.01 Y 15 76363429 T C splice site 6 bp Het probably null 04/21/2021
6 668196 UTSW Tie1 1.000 R8478 G1 225.01 Y 4 118484782 A T splice site Het probably null phenotype 04/21/2021
7 668195 UTSW Polr3c 0.963 R8478 G1 225.01 Y 3 96716750 G A splice site Het probably benign 04/21/2021
8 668194 UTSW Csrnp3 0.171 R8478 G1 225.01 Y 2 65878056 A T splice site 4 bp Het probably null phenotype 04/21/2021
9 668193 UTSW Nlrp1a 0.129 R8482 G1 225.01 Y 11 71109075 A T splice site Het probably null phenotype 04/21/2021
10 668192 UTSW Myo18b 1.000 R8482 G1 225.01 Y 5 112871623 E43* C A nonsense Het probably null phenotype 04/21/2021
11 668191 UTSW Ahctf1 1.000 R8482 G1 225.01 Y 1 179763542 A G unclassified Het probably benign phenotype 04/21/2021
12 668190 UTSW Spsb4 0.157 R8495 G1 225.01 Y 9 96995569 A G splice site 6 bp Het probably null 04/05/2021
13 668189 UTSW Rad9b 1.000 R8495 G1 92.01 Y 5 122333033 T C splice site 6699 bp Het probably null phenotype 04/05/2021
14 668188 UTSW Srcin1 0.000 R8488 G1 147.01 Y 11 97525860 T C splice site 148 bp Het probably null phenotype 03/24/2021
15 668187 UTSW Anapc5 0.957 R8488 G1 225.01 Y 5 122817970 *96Q A G makesense Het probably null phenotype 03/24/2021
16 668186 UTSW Ankrd2 0.000 R8485 G1 225.01 Y 19 42041945 G A splice site Het probably null phenotype 03/24/2021
17 668185 UTSW Fbxl22 0.000 R8485 G1 225.01 Y 9 66514567 C T splice site Het probably null 03/24/2021
18 668184 UTSW Gpi1 1.000 R8485 G1 80.01 Y 7 34219252 A T splice site 9699 bp Het probably null phenotype 03/24/2021
19 668183 UTSW Rho 0.101 R8477 G1 225.01 Y 6 115935385 T A splice site Het probably null phenotype 03/24/2021
20 668182 UTSW Chn2 0.226 R8477 G1 225.01 Y 6 54269482 G T splice site Het probably null phenotype 03/24/2021
21 668181 UTSW Mgam 0.131 R8472 G1 54.01 Y 6 40694526 A T splice site 7916 bp Het probably null phenotype 03/19/2021
22 668180 UTSW Oxnad1 0.066 R8475 G1 96.01 Y 14 32101293 A G splice site Het probably null 03/19/2021
23 668179 UTSW Sephs1 0.898 R8475 G1 144.01 Y 2 4889010 T A splice site Het probably null phenotype 03/19/2021
24 668178 UTSW Dlec1 0.000 R8480 G1 225.01 Y 9 119143267 G A splice site Het probably null 0.976 phenotype 03/19/2021
25 668177 UTSW Aph1b 0.000 R8480 G1 225.01 Y 9 66788427 T A intron Het probably benign phenotype 03/19/2021
26 668176 UTSW Tbcel 0.111 R8480 G1 225.01 Y 9 42463873 G A splice site 8145 bp Het probably null 03/19/2021
27 668175 UTSW Cc2d2a 0.888 R8480 G1 225.01 Y 5 43685144 C A splice site Het probably null 0.976 phenotype 03/19/2021
28 668174 UTSW Fbxl22 0.000 R8467 G1 225.01 Y 9 66514567 C T splice site Het probably null 03/19/2021
29 668173 UTSW Mup9 R8467 G1 225.01 N 4 60420482 C T splice site 5 bp Het probably null 03/19/2021
30 668172 UTSW Sfrp4 0.229 R8544 G1 225.01 Y 13 19632166 A G splice site Het probably null phenotype 03/10/2021
31 668171 UTSW Man2c1 0.000 R8544 G1 119.01 Y 9 57131041 A G splice site Het probably null 0.976 phenotype 03/10/2021
32 668170 UTSW Tbx6 1.000 R8544 G1 225.01 Y 7 126781484 A G splice site Het probably null phenotype 03/10/2021
33 668169 UTSW Trpm1 0.000 R8544 G1 225.01 Y 7 64224608 T A splice site Het probably null phenotype 03/10/2021
34 668168 UTSW Trmt13 0.142 R8544 G1 225.01 Y 3 116592445 A G splice site 19 bp Het probably null 0.976 03/10/2021
35 668167 UTSW Dennd1a 0.207 R8544 G1 101.01 Y 2 37982908 T C splice site Het probably null 0.976 phenotype 03/10/2021
36 668166 UTSW Pcca 1.000 R8463 G1 225.01 Y 14 122685114 A G splice site 89 bp Het probably null phenotype 03/10/2021
37 668165 UTSW Olfr633 0.054 R8463 G1 225.01 Y 7 103946627 G A splice site Het probably null phenotype 03/10/2021
38 668164 UTSW Anapc1 1.000 R8469 G1 225.01 Y 2 128658344 A T splice site Het probably null phenotype 03/10/2021
39 668163 UTSW Apob 0.856 R8481 G1 225.01 Y 12 7994807 T A splice site Het probably null phenotype 03/10/2021
40 668162 UTSW Dlec1 0.000 R8481 G1 225.01 Y 9 119143267 G A splice site Het probably null 0.976 phenotype 03/10/2021
41 668161 UTSW Got2 0.697 R8481 G1 78.01 Y 8 95888524 T A start gained Het probably benign phenotype 03/10/2021
42 668160 UTSW Ttc7 0.738 R8471 G1 225.01 Y 17 87294026 G63R G A missense Het probably benign 0.237 phenotype 03/10/2021
43 668159 UTSW Rarb 0.000 R8471 G1 225.01 Y 14 16548456 T A unclassified Het probably benign phenotype 03/10/2021
44 668158 UTSW Arl15 1.000 R8471 G1 225.01 Y 13 113901096 T A intron Het probably benign 03/10/2021
45 668157 UTSW Ttc21a 0.222 R8471 G1 225.01 Y 9 119963176 C A splice site Het probably null 03/10/2021
46 668156 UTSW Nsd1 1.000 R8462 G1 94.01 Y 13 55298376 T A splice site Het probably null 0.976 phenotype 03/10/2021
47 668155 UTSW Dab1 0.871 R8462 G1 225.01 Y 4 104704207 L230F C T missense Het probably benign 0.103 phenotype 03/10/2021
48 668154 UTSW Stxbp1 0.704 R8462 G1 59.01 Y 2 32817281 C T splice site 5 bp Het probably null phenotype 03/10/2021
49 668153 UTSW Ccdc186 1.000 R8777-TAIL 225.01 N 19 56813361 S108F G A missense Het probably damaging 0.977 03/08/2021
50 668152 UTSW Myof 0.000 R8777-TAIL 225.01 N 19 37980393 V358A A G missense Het probably benign 0.013 phenotype 03/08/2021
51 668151 UTSW Vldlr 0.253 R8777-TAIL 225.01 N 19 27240546 V465L G T missense Het probably benign 0.002 phenotype 03/08/2021
52 668150 UTSW Tubb6 0.000 R8777-TAIL 225.01 N 18 67401528 T166S A T missense Het probably damaging 0.976 03/08/2021
53 668149 UTSW Mib1 1.000 R8777-TAIL 225.01 N 18 10747422 G200S G A missense Het probably benign 0.350 phenotype 03/08/2021
54 668148 UTSW Lrpprc 1.000 R8777-TAIL 225.01 N 17 84751229 Q734H T A missense Het probably benign 0.298 phenotype 03/08/2021
55 668147 UTSW Esp31 0.281 R8777-TAIL 225.01 N 17 38644691 V75A T C missense Het probably benign 0.011 03/08/2021
56 668146 UTSW Mcrs1 1.000 R8777-TAIL 225.01 N 15 99243356 G422S C T missense Het probably damaging 1.000 phenotype 03/08/2021
57 668145 UTSW Pkhd1l1 0.000 R8777-TAIL 225.01 N 15 44498571 Y547H T C missense Het probably damaging 0.997 03/08/2021
58 668144 UTSW Gm49336 R8777-TAIL 225.01 N 14 60228736 L458F G A missense Het probably damaging 0.999 03/08/2021
59 668143 UTSW Nynrin 0.000 R8777-TAIL 225.01 N 14 55871663 M1409T T C missense Het probably benign 0.000 03/08/2021
60 668142 UTSW Rft1 1.000 R8777-TAIL 225.01 N 14 30660199 L51P T C missense Het probably damaging 1.000 phenotype 03/08/2021
61 668141 UTSW Map1b 1.000 R8777-TAIL 225.01 N 13 99430796 T1806A T C missense Het unknown phenotype 03/08/2021
62 668140 UTSW Papd7 0.183 R8777-TAIL 225.01 N 13 69510705 D337V T A missense Het probably damaging 1.000 phenotype 03/08/2021
63 668139 UTSW Zcchc6 0.735 R8777-TAIL 225.01 N 13 59785783 N1302D T C missense Het probably benign 0.146 03/08/2021
64 668138 UTSW Mylk4 0.000 R8777-TAIL 225.01 N 13 32729106 V70I C T missense Het probably benign 0.003 03/08/2021
65 668137 UTSW Nrxn3 0.000 R8777-TAIL 225.01 N 12 89260464 N290D A G missense Het probably damaging 0.998 phenotype 03/08/2021
66 668136 UTSW Myh13 0.123 R8777-TAIL 225.01 N 11 67361335 Q1423L A T missense Het possibly damaging 0.921 03/08/2021
67 668135 UTSW Myh2 0.227 R8777-TAIL 225.01 N 11 67192572 R1454G A G missense Het possibly damaging 0.672 phenotype 03/08/2021
68 668134 UTSW Ncor1 1.000 R8777-TAIL 225.01 N 11 62433668 H47L T A missense Het probably damaging 0.999 phenotype 03/08/2021
69 668133 UTSW Ncor1 1.000 R8777-TAIL 225.01 N 11 62433666 I48F T A missense Het probably benign 0.027 phenotype 03/08/2021
70 668132 UTSW Olfr30 0.064 R8777-TAIL 225.01 N 11 58455931 W6* C T nonsense Het probably null phenotype 03/08/2021
71 668131 UTSW Aff4 1.000 R8777-TAIL 225.01 N 11 53399956 S581N G A missense Het probably damaging 0.997 phenotype 03/08/2021
72 668130 UTSW Timd4 0.061 R8777-TAIL 225.01 N 11 46815482 T37N C A missense Het possibly damaging 0.494 phenotype 03/08/2021
73 668129 UTSW Olfr788 0.096 R8777-TAIL 225.01 N 10 129473505 V271E T A missense Het possibly damaging 0.931 phenotype 03/08/2021
74 668128 UTSW Osbpl8 0.125 R8777-TAIL 225.01 N 10 111293113 N853K T A missense Het probably benign 0.010 phenotype 03/08/2021
75 668127 UTSW Pcsk4 0.000 R8777-TAIL 225.01 N 10 80323723 P405Q G T missense Het probably benign 0.292 phenotype 03/08/2021
76 668126 UTSW Grin3b 0.000 R8777-TAIL 225.01 N 10 79973138 S241C A T missense Het possibly damaging 0.956 phenotype 03/08/2021
77 668125 UTSW Rufy2 0.000 R8777-TAIL 225.01 N 10 62997881 L241V T G missense Het possibly damaging 0.855 03/08/2021
78 668124 UTSW Hkdc1 0.132 R8777-TAIL 225.01 N 10 62398833 I556T A G missense Het possibly damaging 0.940 phenotype 03/08/2021
79 668123 UTSW Hephl1 0.090 R8777-TAIL 225.01 N 9 15060794 D950A T G missense Het probably benign 0.243 03/08/2021
80 668122 UTSW Piwil4 0.207 R8777-TAIL 225.01 N 9 14739389 A C critical splice donor site 2 bp Het probably null phenotype 03/08/2021
81 668121 UTSW Cdh13 0.000 R8777-TAIL 225.01 N 8 119236967 G T critical splice donor site 1 bp Het probably null phenotype 03/08/2021
82 668120 UTSW Slc5a5 0.000 R8777-TAIL 225.01 N 8 70891290 I155V T C missense Het possibly damaging 0.872 phenotype 03/08/2021
83 668119 UTSW Slc7a2 0.000 R8777-TAIL 225.01 N 8 40898954 M18R T G missense Het probably damaging 0.998 phenotype 03/08/2021
84 668118 UTSW Prr36 0.135 R8777-TAIL 100.46 N 8 4216273 TGCTTTGCTGGTCTGTGGAAGAGCGGCTTTGCTGGTCTGTGGAAGAGCGGCTTTGCTGGTCTGTGGAAGAGCGGCTTTGC TGCTTTGCTGGTCTGTGGAAGAGCGGCTTTGCTGGTCTGTGGAAGAGCGGCTTTGC small deletion Het probably benign phenotype 03/08/2021
85 668117 UTSW Mcmbp 1.000 R8777-TAIL 225.01 N 7 128707131 F389I A T missense Het probably damaging 0.997 phenotype 03/08/2021
86 668116 UTSW Tufm 0.955 R8777-TAIL 225.01 N 7 126488862 Y179C A G missense Het probably benign 0.252 phenotype 03/08/2021
87 668115 UTSW Ints4 0.962 R8777-TAIL 225.01 N 7 97485020 A53D C A missense Het probably damaging 0.998 phenotype 03/08/2021
88 668114 UTSW Tenm4 1.000 R8777-TAIL 225.01 N 7 96896037 N2457S A G missense Het probably damaging 0.999 phenotype 03/08/2021
89 668113 UTSW Strn4 0.886 R8777-TAIL 225.01 N 7 16816608 W86R T C missense Het probably damaging 0.997 03/08/2021
90 668112 UTSW Vmn2r42 R8777-TAIL 111.01 N 7 8192693 F485L A G missense Het probably benign 0.141 03/08/2021
91 668111 UTSW Kmt5c 0.000 R8777-TAIL 225.01 N 7 4742713 V124A T C missense Het possibly damaging 0.933 phenotype 03/08/2021
92 668110 UTSW Clec1b 0.063 R8777-TAIL 225.01 N 6 129403574 E151V A T missense Het probably benign 0.051 phenotype 03/08/2021
93 668109 UTSW Gxylt2 0.000 R8777-TAIL 225.01 N 6 100750471 N182S A G missense Het probably damaging 0.989 phenotype 03/08/2021
94 668108 UTSW Mgam 0.131 R8777-TAIL 225.01 N 6 40655251 H173R A G missense Het probably damaging 0.969 phenotype 03/08/2021
95 668107 UTSW Trrap 1.000 R8777-TAIL 225.01 N 5 144837139 V2855D T A missense Het probably benign 0.096 phenotype 03/08/2021
96 668106 UTSW Aimp2 1.000 R8777-TAIL 91.01 N 5 143903007 A253V G A missense Het probably damaging 0.992 phenotype 03/08/2021
97 668105 UTSW Arl6ip4 0.216 R8777-TAIL 225.01 N 5 124116548 S35A T G missense Het probably benign 0.024 03/08/2021
98 668104 UTSW Diablo 0.000 R8777-TAIL 225.01 N 5 123517927 I150F T A missense Het unknown phenotype 03/08/2021
99 668103 UTSW Oas1h 0.066 R8777-TAIL 225.01 N 5 120867044 L185P T C missense Het probably damaging 1.000 03/08/2021
100 668102 UTSW Vmn2r16 0.126 R8777-TAIL 225.01 N 5 109340365 T368M C T missense Het probably benign 0.002 03/08/2021
[records 1 to 100 of 534649] next >> last >|