Incidental Mutations

500,511 incidental mutations are currently displayed, and affect 22,384 genes.
78,558 are Possibly Damaging.
181,552 are Probably Damaging.
174,062 are Probably Benign.
53,505 are Probably Null.
20,810 create premature stop codons.
14,347 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 500511] next >> last >| per page Full List
ID question?
Source question?
Gene question?
E-score question?
Stock # question?
Gen question?
Vld question?
Strain question?
Chr question?
Position question?
Mutation question?
Type question?
Exon Dist question?
Zygosity question?
Predicted Effect question?
PPH Score question?
Meta Score question?
MGI Phenotype question?
Posted question?
1 11 UTSW Adck1 0.000 0152 Y feeble 12 88431151 Q185L A T missense Het probably benign 0.034 0.255 11/03/2009
2 7 UTSW Fscn3 0.222 0152 Y feeble 6 28429967 A G unclassified Homo probably benign 10/27/2009
3 10 UTSW Per1 0.550 0152 Y feeble 11 69104022 T G splice site Het probably benign phenotype 11/11/2009
4 13 UTSW Pkhd1 0.231 0152 Y feeble 1 20522894 I1665S A C missense Het possibly damaging 0.463 0.424 phenotype 11/06/2009
5 9 UTSW Tnrc6a 0.844 0152 Y feeble 7 123180654 P1303T C A missense Het probably damaging 1.000 0.173 phenotype 11/12/2009
6 8 UTSW Usp47 0.668 0152 Y feeble 7 112056577 Y154H T C missense Het probably damaging 0.959 0.093 phenotype 11/02/2009
7 12 UTSW Zfp952 0.082 0152 Y feeble 17 33003221 T A unclassified 135 bp Het probably null 0.619 11/03/2009
8 150 UTSW Afmid 0.000 2107 Y triaka 11 117835561 N198K T A missense Homo probably damaging 1.000 0.647 phenotype 03/22/2010
9 148 UTSW Fam184a 0.205 2107 Y triaka 10 53641057 E374G T C missense Homo probably damaging 0.999 0.140 03/20/2010
10 149 UTSW Mypn 0.190 2107 Y triaka 10 63203751 C T utr 5 prime Homo probably benign 0.090 phenotype 03/22/2010
11 144 UTSW Nme7 0.194 2107 Y triaka 1 164345353 I211N T A missense Het possibly damaging 0.939 0.925 phenotype 03/19/2010
12 145 UTSW Tmod4 0.142 2107 Y triaka 3 95130168 G A unclassified Homo probably null 0.976 phenotype 03/19/2010
13 146 UTSW Wfs1 0.474 2107 Y triaka 5 36967273 R758H C T missense Het probably damaging 0.996 0.267 phenotype 03/19/2010
14 147 UTSW Zfp112 0.175 2107 Y triaka 7 24126841 C745R T C missense Het probably damaging 1.000 0.479 03/19/2010
15 68 UTSW Clca2 0.000 3370 Y dazzle 3 145077977 A626T C T missense Homo probably damaging 1.000 0.227 phenotype 12/08/2009
16 67 UTSW Dido1 0.956 3370 Y dazzle 2 180671542 M979T A G missense Homo probably benign 0.000 0.090 phenotype 12/08/2009
17 69 UTSW Mnx1 1.000 3370 Y dazzle 5 29474887 C241R A G missense Homo unknown 0.368 phenotype 12/08/2009
18 70 UTSW Rab38 0.610 3370 Y dazzle 7 88490651 H176R A G missense Homo probably benign 0.003 0.061 phenotype 12/08/2009
19 72 UTSW Tap2 0.127 3370 Y dazzle 17 34209279 A G unclassified 3911 bp Homo probably null 0.799 phenotype 12/08/2009
20 71 UTSW Tmem167 0.428 3370 Y dazzle 13 90098466 K36N A C missense Homo probably damaging 0.989 0.491 12/08/2009
21 135 UTSW Ankmy2 0.682 7510 G3 Y sublytic 12 36157412 V19A T C missense Het probably benign 0.057 0.088 03/12/2010
22 136 UTSW Camk4 0.103 7510 G3 Y sublytic 18 33156839 A180S G T missense Homo probably null 0.990 0.356 phenotype 03/12/2010
23 134 UTSW Slc28a1 0.099 7510 G3 Y sublytic 7 81169269 V622A T C missense Het probably benign 0.000 0.090 03/12/2010
24 23 UTSW Capn9 0.083 A2778 Y phoebus 8 124605478 F396S T C missense Homo possibly damaging 0.953 0.691 phenotype 11/09/2009
25 107 UTSW Asap1 0.161 A4554 Y gemini 15 64124711 T C splice site Het probably benign phenotype 03/16/2010
26 94 UTSW Bpifb5 0.000 A4554 Y gemini 2 154227180 Y139F A T missense Homo possibly damaging 0.707 0.179 03/16/2010
27 101 UTSW Chd2 0.681 A4554 Y gemini 7 73480968 V782G A C missense Homo probably benign 0.000 0.090 phenotype 03/16/2010
28 109 UTSW Chst4 0.069 A4554 Y gemini 8 110029888 Q448K G T missense Homo probably benign 0.085 0.073 phenotype 03/16/2010
29 110 UTSW Dido1 0.956 A4554 Y gemini 2 180675371 K8E T C missense Homo probably damaging 0.998 0.067 phenotype 03/16/2010
30 108 UTSW Evpl 0.000 A4554 Y gemini 11 116220834 L2010P A G missense Homo probably damaging 0.999 0.160 phenotype 03/16/2010
31 96 UTSW Fgl2 0.260 A4554 Y gemini 5 21372778 E21G A G missense Homo probably benign 0.007 0.090 phenotype 03/16/2010
32 103 UTSW Greb1l 1.000 A4554 Y gemini 18 10532862 M919L A T missense Homo possibly damaging 0.585 0.227 03/16/2010
33 99 UTSW Kel 0.097 A4554 Y gemini 6 41697419 D359V T A missense Homo possibly damaging 0.948 0.223 phenotype 03/16/2010
34 97 UTSW Lmtk2 0.307 A4554 Y gemini 5 144166317 D298G A G missense Homo possibly damaging 0.820 0.061 phenotype 03/16/2010
35 105 UTSW Masp1 0.143 A4554 Y gemini 16 23454940 A T splice site Homo probably null 0.976 phenotype 03/16/2010
36 100 UTSW Mrgprb8 0.000 A4554 Y gemini 7 48389408 I276F A T missense Homo probably damaging 0.999 0.611 03/16/2010
37 106 UTSW Nde1 0.734 A4554 Y gemini 16 14188410 T C splice site Homo probably benign phenotype 03/16/2010
38 93 UTSW Rbck1 0.000 A4554 Y gemini 2 152319172 N385K G T missense Homo probably damaging 0.999 0.647 phenotype 03/16/2010
39 132 UTSW Senp6 1.000 A4554 Y gemini 9 80148458 G T unclassified Het probably benign 0.090 phenotype 03/16/2010
40 95 UTSW Tm4sf4 0.000 A4554 Y gemini 3 57437767 T A critical splice donor site 2 bp Homo probably null 0.949 phenotype 03/16/2010
41 98 UTSW Ubn2 0.733 A4554 Y gemini 6 38484110 H488L A T missense Homo probably damaging 0.999 0.085 03/16/2010
42 104 UTSW Vmn2r120 0.084 A4554 Y gemini 17 57525715 F155L A G missense Homo probably benign 0.011 0.090 03/16/2010
43 102 UTSW Vmn2r65 0.068 A4554 Y gemini 7 84946583 T298S T A missense Homo probably damaging 0.958 0.647 03/16/2010
44 61 UTSW Kat14 1.000 A5278 Y 453 2 144393307 S18* C A nonsense Het probably null 0.971 phenotype 12/03/2009
45 63 UTSW Kif17 0.246 A5278 Y 453 4 138287950 V278A T C missense Homo probably benign 0.326 0.063 phenotype 12/03/2009
46 60 UTSW Myo3a 0.000 A5278 Y 453 2 22323653 T353A A G missense Het probably benign 0.269 0.109 phenotype 12/03/2009
47 66 UTSW Pbk 0.311 A5278 Y 453 14 65813939 I142N T A missense Het probably damaging 1.000 0.917 phenotype 12/03/2009
48 74 UTSW Rab32 0.136 A5278 Y 453 10 10557973 I39T A G missense Het possibly damaging 0.941 0.570 phenotype 01/05/2010
49 64 UTSW Rhou 0.000 A5278 Y 453 8 123660991 C154F G T missense Het probably damaging 0.991 phenotype 12/03/2009
50 65 UTSW Slc4a1 1.000 A5278 Y 453 11 102353815 A G splice site Het probably benign phenotype 12/03/2009
51 62 UTSW Tdrd7 0.558 A5278 Y 453 4 46007622 T558M C T missense Homo probably benign 0.007 0.090 phenotype 12/03/2009
52 19 UTSW Ablim1 0.487 A9681 G3 Y atchoum 19 57173323 A G critical splice donor site 2 bp Homo probably null 0.949 phenotype 11/06/2009
53 15 UTSW Akap2 0.099 A9681 G3 Y atchoum 4 57855358 Q270R A G missense Het probably damaging 0.999 0.109 phenotype 11/09/2009
54 18 UTSW Gm9943 A9681 G3 Y atchoum 17 16014992 T A Het 11/10/2009
55 16 UTSW Ints1 1.000 A9681 G3 Y atchoum 5 139770139 E538G T C missense Homo possibly damaging 0.564 0.762 phenotype 11/10/2009
56 17 UTSW Olfr664 0.089 A9681 G3 Y atchoum 7 104734403 T C unclassified Het probably benign 11/11/2009
57 14 UTSW Pld1 0.000 A9681 G3 Y atchoum 3 28085832 H600Q C A missense Homo probably benign 0.007 0.090 phenotype 11/11/2009
58 262514 UTSW 1110038F14Rik ANU05 225 N 15 76950275 V124I G A missense Het probably damaging 0.999 02/04/2015
59 262520 UTSW 1700019N19Rik 0.000 ANU05 225 N 19 58789113 H80Q A T missense Het probably damaging 1.000 02/04/2015
60 262502 UTSW Acaca 1.000 ANU05 225 N 11 84315852 K1513E A G missense Het probably damaging 0.999 phenotype 02/04/2015
61 262482 UTSW Acacb 0.000 ANU05 225 N 5 114225870 F1464Y T A missense Het probably benign 0.027 phenotype 02/04/2015
62 262497 UTSW Adgrg6 1.000 ANU05 225 N 10 14410530 A1114V G A missense Het possibly damaging 0.918 phenotype 02/04/2015
63 262475 UTSW Agl 0.261 ANU05 225 N 3 116772789 I975T A G missense Het possibly damaging 0.485 phenotype 02/04/2015
64 262498 UTSW Akap7 0.000 ANU05 225 N 10 25271553 H93R T C missense Het probably damaging 1.000 phenotype 02/04/2015
65 262474 UTSW Arhgef11 0.000 ANU05 225 N 3 87733174 W1213R T C missense Het probably benign 0.001 phenotype 02/04/2015
66 262499 UTSW Ccar1 0.921 ANU05 225 N 10 62756649 E708V T A missense Het probably damaging 0.996 02/04/2015
67 262477 UTSW Cfap206 0.302 ANU05 225 N 4 34721562 S162N C T missense Het probably damaging 1.000 02/04/2015
68 262494 UTSW Cilp 0.000 ANU05 225 N 9 65278983 S787P T C missense Het possibly damaging 0.803 phenotype 02/04/2015
69 262463 UTSW Col6a3 0.000 ANU05 225 N 1 90802292 T1157I G A missense Het probably damaging 0.998 phenotype 02/04/2015
70 262472 UTSW D630003M21Rik 0.076 ANU05 225 N 2 158196388 Y1046C T C missense Het probably benign 0.005 02/04/2015
71 262495 UTSW Dock3 0.578 ANU05 225 N 9 106895663 S464P A G missense Het probably benign 0.000 phenotype 02/04/2015
72 262470 UTSW Dusp19 0.223 ANU05 225 N 2 80624274 T113A A G missense Het probably benign 0.008 phenotype 02/04/2015
73 262507 UTSW Dync1h1 1.000 ANU05 225 N 12 110649104 Y2957S A C missense Het probably benign 0.311 phenotype 02/04/2015
74 262510 UTSW Epdr1 0.000 ANU05 225 N 13 19594644 Y94C T C missense Het probably damaging 0.999 phenotype 02/04/2015
75 262492 UTSW Fcho1 0.231 ANU05 225 N 8 71712547 L422Q A T missense Het probably benign 0.082 02/04/2015
76 262468 UTSW Gca 0.121 ANU05 225 N 2 62690443 Y210* T A nonsense Het probably null phenotype 02/04/2015
77 262485 UTSW Gpnmb 0.000 ANU05 225 N 6 49055681 V513A T C missense Het probably benign 0.117 phenotype 02/04/2015
78 262512 UTSW Irx4 0.873 ANU05 225 N 13 73267667 T192A A G missense Het probably damaging 0.998 phenotype 02/04/2015
79 262511 UTSW Isca1 1.000 ANU05 225 N 13 59758971 T54A T C missense Het probably benign 0.007 phenotype 02/04/2015
80 262478 UTSW Kif12 0.310 ANU05 106 N 4 63171423 GGGGC GGGGCCTCCACCCGGCGGGC small insertion Het probably benign phenotype 02/04/2015
81 262473 UTSW L3mbtl1 0.000 ANU05 216 N 2 162970180 V715A T C missense Het probably benign 0.301 phenotype 02/04/2015
82 262517 UTSW Lama1 1.000 ANU05 104 N 17 67738870 D257N G A missense Het probably damaging 0.996 phenotype 02/04/2015
83 262501 UTSW Lgr5 1.000 ANU05 225 N 10 115478534 H166R T C missense Het probably damaging 1.000 phenotype 02/04/2015
84 262486 UTSW M6pr 0.000 ANU05 225 N 6 122312259 R9G A G missense Het probably benign 0.077 phenotype 02/04/2015
85 262466 UTSW Nmt2 0.122 ANU05 225 N 2 3314694 S240R T G missense Het probably benign 0.000 phenotype 02/04/2015
86 262505 UTSW Npas3 0.915 ANU05 110 N 12 54068074 E593G A G missense Het possibly damaging 0.491 phenotype 02/04/2015
87 262471 UTSW Olfr1076 0.084 ANU05 225 N 2 86509169 A237T G A missense Het possibly damaging 0.907 phenotype 02/04/2015
88 262479 UTSW Pank4 0.154 ANU05 225 N 4 154974646 M412T T C missense Het probably damaging 0.979 phenotype 02/04/2015
89 262519 UTSW Psd 0.000 ANU05 192 N 19 46314747 V100A A G missense Het possibly damaging 0.766 phenotype 02/04/2015
90 262515 UTSW Rab11fip3 0.000 ANU05 225 N 17 26016113 T28A T C missense Het probably damaging 0.994 phenotype 02/04/2015
91 262464 UTSW Rnpepl1 0.000 ANU05 153 N 1 92919746 D685V A T missense Het probably benign 0.000 02/04/2015
92 262493 UTSW Rrad 0.000 ANU05 224 N 8 104630651 E88G T C missense Het probably benign 0.001 phenotype 02/04/2015
93 262503 UTSW Sdk2 0.095 ANU05 225 N 11 113843080 M846L T A missense Het probably benign 0.000 phenotype 02/04/2015
94 262481 UTSW Sparcl1 0.000 ANU05 225 N 5 104094715 V36E A T missense Het possibly damaging 0.879 phenotype 02/04/2015
95 262483 UTSW Srrm4 0.280 ANU05 225 N 5 116467569 E210K C T missense Het unknown phenotype 02/04/2015
96 262465 UTSW Stk25 0.000 ANU05 156 N 1 93623423 A T unclassified 2427 bp Het probably null phenotype 02/04/2015
97 262476 UTSW Tacr3 0.000 ANU05 225 N 3 134930049 Y338F A T missense Het probably damaging 1.000 phenotype 02/04/2015
98 262516 UTSW Tap2 0.127 ANU05 196 N 17 34209210 Q286L A T missense Het probably benign 0.010 phenotype 02/04/2015
99 262508 UTSW Tedc1 1.000 ANU05 225 N 12 113163188 R357* C T nonsense Het probably null 02/04/2015
100 262490 UTSW Tubgcp5 0.964 ANU05 225 N 7 55808529 A396E C A missense Het possibly damaging 0.829 02/04/2015
[records 1 to 100 of 500511] next >> last >|