Incidental Mutations

9,423 incidental mutations are currently displayed, and affect 4,167 genes.
0 are Possibly Damaging.
0 are Probably Damaging.
8,929 are Probably Benign.
6 are Probably Null.
0 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 9423] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 306639 APN 0610009L18Rik IGL00978 G1 11 120350947 T C unclassified Het probably benign 04/16/2015
2 328269 UTSW 0610040J01Rik 0.093 R4428 G1 225 Y 5 63898839 G T unclassified Het probably benign 0.169 07/07/2015
3 328314 UTSW 0610040J01Rik 0.093 R4429 G1 154 N 5 63898839 G T unclassified Het probably benign 0.169 07/07/2015
4 328558 UTSW 0610040J01Rik 0.093 R4430 G1 198 N 5 63898839 G T unclassified Het probably benign 0.169 07/21/2015
5 328606 UTSW 0610040J01Rik 0.093 R4431 G1 143 Y 5 63898839 G T unclassified Het probably benign 0.169 07/21/2015
6 330267 UTSW 0610040J01Rik 0.093 R4464 G1 186 Y 5 63898839 G T unclassified Het probably benign 0.169 07/21/2015
7 330300 UTSW 0610040J01Rik 0.093 R4465 G1 137 N 5 63898839 G T unclassified Het probably benign 0.169 07/21/2015
8 329229 UTSW 0610040J01Rik 0.093 R4467 G1 225 Y 5 63898839 G T unclassified Het probably benign 0.169 07/21/2015
9 183972 APN 1110002L01Rik IGL02021 G1 12 3407890 G A unclassified Het probably benign 05/07/2014
10 300847 APN 1110002L01Rik IGL02621 12 3426688 C A unclassified Het probably benign 04/16/2015
11 88704 APN 1110008E08Rik 0.075 IGL01483 G1 16 90554313 G T unclassified Het noncoding transcript 11/18/2013
12 329973 UTSW 1110008E08Rik 0.075 R4457 G1 225 Y 16 90554372 A G unclassified Het noncoding transcript 0.087 07/21/2015
13 424683 UTSW 1110008E08Rik 0.075 R5290 G1 214 Y 16 90554210 A T unclassified Het noncoding transcript 0.087 08/04/2016
14 332901 UTSW 1110017D15Rik 0.000 R4516 G1 225 Y 4 41517200 T C unclassified Het probably benign 0.090 phenotype 08/18/2015
15 395860 UTSW 1110017D15Rik 0.000 R5132 G1 225 Y 4 41517178 A G unclassified Het probably benign phenotype 06/21/2016
16 622266 UTSW 1110032A03Rik 0.000 Z1176 216.01 N 9 50768219 C A unclassified Het probably benign 01/23/2020
17 76993 UTSW 1110059E24Rik 0.259 R0123 G1 64 Y 19 21598201 T C unclassified Het probably benign 0.090 10/16/2013
18 172378 UTSW 1110059E24Rik 0.259 R0134 G1 159 Y 19 21598201 T C unclassified Het probably benign 0.090 04/21/2014
19 219587 UTSW 1110059E24Rik 0.259 R1969 G1 117 N 19 21598245 T C unclassified Het probably benign 08/25/2014
20 685264 UTSW 1110059E24Rik 0.259 R9005 G1 225.01 N 19 21652711 C T unclassified Het probably benign 10/11/2021
21 89578 APN 1500002C15Rik IGL01526 G1 4 155734171 G T unclassified Het probably benign 12/03/2013
22 415172 APN 1500002C15Rik IGL03268 4 155734191 G T unclassified Het probably benign 08/02/2016
23 550106 UTSW 1500009C09Rik 0.090 R7089 G1 126.01 Y 15 82252573 A T unclassified Het probably benign 05/15/2019
24 332612 APN 1500035N22Rik IGL00562 G1 5 24997621 T C unclassified Het probably benign 08/05/2015
25 332618 APN 1500035N22Rik IGL00563 G1 5 24997621 T C unclassified Het probably benign 08/05/2015
26 287789 APN 1500035N22Rik IGL02311 5 24997707 C A unclassified Het probably benign 04/16/2015
27 418154 APN 1500035N22Rik IGL03087 5 24997632 C T unclassified Het probably benign 08/02/2016
28 420068 APN 1500035N22Rik IGL03365 5 24997811 T G unclassified Het probably benign 08/02/2016
29 298112 APN 1600012P17Rik 0.084 IGL02551 1 158969048 G A unclassified Het noncoding transcript 04/16/2015
30 414617 APN 1600012P17Rik 0.084 IGL03255 1 158969351 A G unclassified Het noncoding transcript 08/02/2016
31 208579 UTSW 1600012P17Rik 0.084 R1865 G1 225 Y 1 158969524 A G unclassified Het noncoding transcript 06/30/2014
32 223743 UTSW 1600012P17Rik 0.084 R2020 G1 225 Y 1 158968912 C A unclassified Het noncoding transcript 08/25/2014
33 359482 UTSW 1600012P17Rik 0.084 R4739 G1 225 Y 1 158969334 C T unclassified Het noncoding transcript 11/11/2015
34 356922 UTSW 1600012P17Rik 0.084 R4762 G1 225 Y 1 158969556 T C unclassified Het noncoding transcript 11/11/2015
35 243413 UTSW 1700001C19Rik 0.049 R2256 G1 217 Y 17 47433423 AC A unclassified Het probably benign 0.090 10/16/2014
36 243483 UTSW 1700001C19Rik 0.049 R2257 G1 204 Y 17 47433423 AC A unclassified Het probably benign 0.090 10/16/2014
37 273682 UTSW 1700001C19Rik 0.049 R3498 G1 217 Y 17 47433423 AC A unclassified Het probably benign 0.090 04/02/2015
38 273727 UTSW 1700001C19Rik 0.049 R3499 G1 217 Y 17 47433423 AC A unclassified Het probably benign 0.090 04/02/2015
39 275564 UTSW 1700001C19Rik 0.049 R3834 G1 217 Y 17 47433423 AC A unclassified Het probably benign 0.090 04/06/2015
40 275608 UTSW 1700001C19Rik 0.049 R3835 G1 217 Y 17 47433423 AC A unclassified Het probably benign 0.090 04/06/2015
41 308997 UTSW 1700001C19Rik 0.049 R3901 G1 217 Y 17 47433423 AC A unclassified Het probably benign 0.090 04/17/2015
42 309355 UTSW 1700001C19Rik 0.049 R3910 G1 217 Y 17 47433423 AC A unclassified Het probably benign 0.090 04/17/2015
43 309425 UTSW 1700001C19Rik 0.049 R3911 G1 215 Y 17 47433423 AC A unclassified Het probably benign 0.090 04/17/2015
44 309536 UTSW 1700001C19Rik 0.049 R3913 G1 217 Y 17 47433423 AC A unclassified Het probably benign 0.090 04/17/2015
45 511036 UTSW 1700001K19Rik 0.057 FR4304 148.79 N 12 110668450 TTC TTCGTC unclassified Homo probably benign 04/05/2018
46 511035 UTSW 1700001K19Rik 0.057 FR4304 175.59 N 12 110668449 CTT CTTTTT unclassified Homo probably benign 04/05/2018
47 512099 UTSW 1700001K19Rik 0.057 FR4548 214.47 N 12 110668449 CTT CTTTTT unclassified Het probably benign 04/05/2018
48 512100 UTSW 1700001K19Rik 0.057 FR4548 217.47 N 12 110668452 CTT CTTTTT unclassified Het probably benign 04/05/2018
49 511718 UTSW 1700001K19Rik 0.057 FR4737 200.47 N 12 110668448 TCT TCTCCT unclassified Het probably benign 04/05/2018
50 511925 UTSW 1700001K19Rik 0.057 FR4976 201.47 N 12 110668447 TTC TTCATC unclassified Het probably benign 04/05/2018
51 511926 UTSW 1700001K19Rik 0.057 FR4976 187.47 N 12 110668450 TTC TTCGTC unclassified Het probably benign 04/05/2018
52 332403 APN 1700009J07Rik IGL00429 G1 10 77893839 G A unclassified Het probably benign 08/05/2015
53 57526 UTSW 1700012B07Rik 0.055 R0626 G1 225 N 11 109788721 T C unclassified Het probably benign 07/11/2013
54 423195 UTSW 1700017D01Rik 0.062 R5330 G1 171 Y 19 11091858 A G unclassified Het probably benign 08/04/2016
55 423290 UTSW 1700017D01Rik 0.062 R5331 G1 197 Y 19 11091858 A G unclassified Het probably benign 08/04/2016
56 267272 UTSW 1700017G19Rik 0.094 R3438 G1 225 Y 3 40521524 A G unclassified Het noncoding transcript 0.087 02/18/2015
57 342937 UTSW 1700017G19Rik 0.094 R4558 G1 225 Y 3 40513091 A G unclassified Het noncoding transcript 09/24/2015
58 342972 UTSW 1700017G19Rik 0.094 R4559 G1 225 Y 3 40513091 A G unclassified Het noncoding transcript 09/24/2015
59 369505 UTSW 1700017G19Rik 0.094 R4812 G1 225 Y 3 40521484 C T unclassified Het noncoding transcript 0.087 02/04/2016
60 91985 APN 1700018A14Rik IGL01610 G1 18 46199566 T C unclassified Het probably benign phenotype 12/09/2013
61 251078 UTSW 1700021F05Rik 0.131 R2497 G1 225 Y 10 43525267 T C unclassified Het probably benign 0.217 12/04/2014
62 15423 UTSW 1700028P14Rik 0.147 R0036 G1 Y 19 23616568 A T unclassified Het probably benign 0.252 12/21/2012
63 74614 APN 1700029J07Rik 0.059 IGL01335 G1 8 45973605 A T unclassified Het probably benign 10/07/2013
64 93537 APN 1700034H15Rik IGL01634 G1 1 191900904 A T unclassified Het noncoding transcript 12/09/2013
65 299357 APN 1700034H15Rik IGL02581 1 191903540 A G unclassified Het probably benign 04/16/2015
66 424437 UTSW 1700061G19Rik 0.106 R5287 G1 199 N 17 56876221 G T unclassified Het probably benign 08/04/2016
67 430141 UTSW 1700061G19Rik 0.106 R5403 G1 225 N 17 56876221 G T unclassified Het probably benign 09/06/2016
68 46381 UTSW 1700067K01Rik 1.000 R0570 G1 225 Y 8 84003104 C A unclassified Het probably benign 0.090 06/11/2013
69 61449 UTSW 1700067K01Rik 1.000 R0671 G1 93 Y 8 84003008 T C unclassified Het probably benign 07/30/2013
70 50291 APN 1700101I19Rik IGL01114 G1 1 34579289 T C unclassified Het probably benign 06/21/2013
71 622 UTSW 1700102H20Rik B6584 G3 Y supermodel 17 3559578 C T unclassified Homo probably benign 04/12/2011
72 446575 UTSW 1700128F08Rik 0.891 R5699 G1 225 N 9 8225319 A G unclassified Het noncoding transcript 11/21/2016
73 629740 UTSW 1810011H11Rik 0.068 R8087 G1 124.01 N 14 32785969 G T unclassified Het probably benign 06/30/2020
74 5801 APN 1810013L24Rik 0.918 IGL00484 G1 16 8831311 T C unclassified Het probably benign 04/20/2012
75 619483 UTSW 1810013L24Rik 0.918 R8057 G1 111.01 Y 16 8830368 C T unclassified Het probably benign 01/23/2020
76 306788 APN 1810062G17Rik 0.086 IGL00226 G1 3 36479541 C A unclassified Het probably benign 04/16/2015
77 394306 UTSW 1810062G17Rik 0.086 R5045 G1 225 N 3 36476178 T C unclassified Het probably benign 06/15/2016
78 41085 UTSW 1810064F22Rik 0.142 R0066 G1 225 Y 9 22207881 A G unclassified Het noncoding transcript 05/23/2013
79 81426 UTSW 1810064F22Rik 0.142 R0940 G1 225 Y 9 22208071 C T unclassified Het noncoding transcript 11/07/2013
80 82754 UTSW 1810064F22Rik 0.142 R0942 G1 225 Y 9 22208071 C T unclassified Het noncoding transcript 11/08/2013
81 373805 UTSW 1810064F22Rik 0.142 R4854 G1 225 Y 9 22208037 T A unclassified Het noncoding transcript 0.087 03/01/2016
82 428158 UTSW 1810064F22Rik 0.142 R5433 G1 225 Y 9 22207743 A G unclassified Het noncoding transcript 09/01/2016
83 282782 APN 2010007H06Rik IGL02168 9 51280501 T C unclassified Het probably benign 04/16/2015
84 529901 UTSW 2010109A12Rik 0.103 R6727 G1 168.01 Y 5 93206575 A G unclassified Het probably benign 08/01/2018
85 324948 UTSW 2200002D01Rik 0.089 R4362 G1 225 Y 7 29248262 C T unclassified Het probably benign 07/06/2015
86 684023 UTSW 2200002D01Rik 0.089 R8986 G1 217.47 N 7 29247623 CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC unclassified Het probably benign 10/11/2021
87 664846 UTSW 2200002D01Rik 0.089 Z1186 173.47 N 7 29247604 GCCTTCTTCTCCTTCTTCTCCTTCT GCCTTCTTCTCCTTCT unclassified Het probably benign 03/08/2021
88 6 UTSW 2210011C24Rik 0.074 E2594 Y daniel_gray 8 84010702 G A unclassified Het probably benign 0.090 10/27/2009
89 29983 UTSW 2310003L06Rik 0.066 R0359 G1 225 Y 5 87964596 A T unclassified Het probably benign 04/24/2013
90 61648 UTSW 2310003L06Rik 0.066 R0676 G1 123 Y 5 87964657 A G unclassified Het probably benign 0.090 07/30/2013
91 233374 UTSW 2310003L06Rik 0.066 R2132 G1 225 Y 5 87964476 A G unclassified Het probably benign 10/01/2014
92 309912 UTSW 2310003L06Rik 0.066 R3748 G1 225 Y 5 87964563 A G unclassified Het probably benign 04/17/2015
93 352422 UTSW 2310003L06Rik 0.066 R4656 G1 225 Y 5 87964675 G A unclassified Het probably benign 10/08/2015
94 8437 APN 2310030G06Rik 0.054 IGL00672 G1 9 50746436 A G unclassified Het probably benign 12/06/2012
95 271571 UTSW 2310033P09Rik 0.166 R1476 G1 167 Y 11 59208702 A G unclassified Het probably benign 0.090 03/23/2015
96 666780 UTSW 2310033P09Rik 0.166 Z1190 105.03 N 11 59208367 G A unclassified Het probably benign 03/08/2021
97 16294 UTSW 2310061I04Rik 0.359 R0098 G1 Y 17 35896417 A T unclassified Het probably benign 0.090 01/20/2013
98 488548 UTSW 2410004P03Rik 0.060 R6140 G1 129.01 Y 12 17005922 T C unclassified Het probably benign 0.090 10/10/2017
99 501922 UTSW 2410022M11Rik 0.445 R5691 G1 78 Y 14 56812373 A G unclassified Het probably benign 12/20/2017
100 72477 UTSW 2410089E03Rik 1.000 R0762 G1 193 Y 15 8218416 A G unclassified Het probably benign phenotype 09/30/2013
[records 1 to 100 of 9423] next >> last >|