Incidental Mutations

11,537 incidental mutations are currently displayed, and affect 6,677 genes.
0 are Possibly Damaging.
0 are Probably Damaging.
315 are Probably Benign.
11,179 are Probably Null.
0 create premature stop codons.
11,537 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 11537] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 46973 UTSW 0610009O20Rik 0.301 R0511 G1 225 Y 18 38254071 T C critical splice donor site 2 bp Het probably null 0.950 06/11/2013
2 326976 UTSW 0610009O20Rik 0.301 R4418 G1 225 Y 18 38261287 T C critical splice donor site 2 bp Het probably null 0.976 07/07/2015
3 89459 APN 0610010F05Rik 0.195 IGL01522 G1 11 23582865 A G critical splice donor site 2 bp Het probably null 12/03/2013
4 396740 UTSW 0610010F05Rik 0.195 R5156 G1 225 Y 11 23593424 A G critical splice donor site 2 bp Het probably null 0.949 06/21/2016
5 227312 UTSW 1110017D15Rik 0.000 R2073 G1 225 N 4 41507519 A G critical splice donor site 2 bp Het probably null phenotype 09/17/2014
6 558554 UTSW 1300017J02Rik 0.288 R7175 G1 225.01 Y 9 103251789 A G critical splice donor site 2 bp Het probably null 06/26/2019
7 266808 UTSW 1500009L16Rik 0.000 R3416 G1 225 Y 10 83759632 T C critical splice donor site 2 bp Het probably null 0.949 02/18/2015
8 26834 APN 1500012F01Rik IGL00903 G1 2 167065486 G T critical splice donor site 6 bp Het probably benign 04/17/2013
9 547814 UTSW 1700001C19Rik 0.060 R7054 G1 225.01 Y 17 47437189 A G critical splice donor site 2 bp Het probably null 05/13/2019
10 563668 UTSW 1700006A11Rik 0.069 R7248 G1 225.01 Y 3 124414310 A G critical splice donor site 2 bp Het probably null 06/26/2019
11 51166 APN 1700007G11Rik 0.140 IGL01133 G1 5 98498381 T C critical splice donor site 2 bp Het probably null 06/21/2013
12 29378 APN 1700010I14Rik 0.000 IGL00988 G1 17 8997105 T C critical splice donor site 2 bp Het probably null 04/17/2013
13 42078 UTSW 1700010I14Rik 0.000 R0482 G1 225 Y 17 8988423 T C critical splice donor site 2 bp Het probably null 0.947 05/23/2013
14 304149 APN 1700015F17Rik 0.102 IGL02701 5 5466623 A G critical splice donor site 2 bp Het probably null 04/16/2015
15 265174 UTSW 1700015F17Rik 0.102 R3056 G1 225 N 5 5457283 A T critical splice donor site 2 bp Het probably null 02/05/2015
16 624847 UTSW 1700015F17Rik 0.102 Z1177 225.01 N 5 5457284 C T critical splice donor site 1 bp Het probably null 01/23/2020
17 542224 UTSW 1700017D01Rik 0.078 R6970 G1 225.01 N 19 11112314 A G critical splice donor site 2 bp Het probably null 11/28/2018
18 298525 APN 1700017N19Rik 0.073 IGL02556 10 100610717 T G critical splice donor site 2 bp Het probably null 04/16/2015
19 546548 UTSW 1700017N19Rik 0.073 R7034 G1 225.01 N 10 100609256 T A critical splice donor site 2 bp Het probably null 05/13/2019
20 546702 UTSW 1700017N19Rik 0.073 R7036 G1 225.01 N 10 100609256 T A critical splice donor site 2 bp Het probably null 05/13/2019
21 304113 APN 1700018B08Rik 0.064 IGL02700 8 121535422 C A critical splice donor site 1 bp Het probably null 04/16/2015
22 539586 UTSW 1700018B08Rik 0.064 R6920 G1 225.01 Y 8 121535421 A G critical splice donor site 2 bp Het probably null 0.938 11/06/2018
23 311460 UTSW 1700021F07Rik 0.066 R4006 G1 225 N 2 173526087 T C critical splice donor site 2 bp Het probably null 04/29/2015
24 231555 UTSW 1700021P04Rik 0.065 R2087 G1 147 Y 19 24065000 T A critical splice donor site Het noncoding transcript 09/18/2014
25 104905 APN 1700030K09Rik 0.053 IGL01714 G1 8 72455569 T C critical splice donor site 2 bp Het probably null 01/21/2014
26 415371 APN 1700037H04Rik IGL03274 2 131153592 A T critical splice donor site 2 bp Het probably null 08/02/2016
27 512406 UTSW 1700061G19Rik 0.092 R6357 G1 170.01 N 17 56877591 T C critical splice donor site 2 bp Het probably null 04/27/2018
28 151721 UTSW 1700074P13Rik 0.057 R1250 G1 225 N 6 40925975 A T critical splice donor site 2 bp Het probably null 01/29/2014
29 440288 UTSW 1700123K08Rik 0.058 R5610 G1 225 N 5 138564141 A G critical splice donor site 2 bp Het probably null 11/08/2016
30 456485 UTSW 1810062G17Rik 0.133 R5905 G1 225 N 3 36479569 T A critical splice donor site 2 bp Het probably null 0.976 02/15/2017
31 480155 UTSW 1810062G17Rik 0.133 R6028 G1 225.01 Y 3 36479569 T A critical splice donor site 2 bp Het probably null 0.976 06/26/2017
32 234841 UTSW 1810065E05Rik 0.126 R2156 G1 225 N 11 58422308 T A critical splice donor site 2 bp Het probably null 10/01/2014
33 393810 UTSW 2010315B03Rik 0.072 R5110 G1 225 Y 9 124295357 C A critical splice donor site 1 bp Het probably null 0.976 06/15/2016
34 105226 APN 2200002D01Rik 0.089 IGL01724 G1 7 29247896 C T critical splice donor site 1 bp Het probably null 01/21/2014
35 374679 UTSW 2210407C18Rik 0.062 R4863 G1 225 Y 11 58612512 A T critical splice donor site 2 bp Het probably null 0.976 03/17/2016
36 407576 APN 2210408I21Rik 0.000 IGL03006 13 77323772 T C critical splice donor site 2 bp Het probably null 08/02/2016
37 326282 UTSW 2210408I21Rik 0.000 R4387 G1 225 N 13 77316574 T A critical splice donor site 2 bp Het probably null 0.949 07/06/2015
38 326316 UTSW 2210408I21Rik 0.000 R4388 G1 225 Y 13 77316574 T A critical splice donor site 2 bp Het probably null 0.949 07/06/2015
39 203614 UTSW 2310011J03Rik 0.054 R1808 G1 225 N 10 80320181 A G critical splice donor site 2 bp Het probably null 06/23/2014
40 506986 UTSW 2310035C23Rik 0.413 R6266 G1 225.01 N 1 105731282 T G critical splice donor site 2 bp Het probably null 03/15/2018
41 566461 UTSW 2310035C23Rik 0.413 R7292 G1 225.01 Y 1 105721416 G T critical splice donor site 1 bp Het probably null 06/26/2019
42 472880 UTSW 2310057J18Rik 0.000 R4801 G1 225 N 10 28983926 A G critical splice donor site 2 bp Het probably null 0.949 04/14/2017
43 370313 UTSW 2310057J18Rik 0.000 R4802 G1 225 Y 10 28983926 A G critical splice donor site 2 bp Het probably null 0.949 02/04/2016
44 436180 UTSW 2410004B18Rik 0.364 R5545 G1 225 N 3 145939098 T C critical splice donor site 2 bp Het probably null 10/24/2016
45 596341 UTSW 2410141K09Rik 0.113 R7737 G1 225.01 Y 13 66433677 A G critical splice donor site 2 bp Het probably null 11/26/2019
46 383621 UTSW 2610318N02Rik 0.000 R4948 G1 127 Y 16 17118290 A T critical splice donor site 2 bp Het probably null 0.976 04/27/2016
47 272395 UTSW 2610507B11Rik 0.964 R3788 G1 225 Y 11 78288297 T A critical splice donor site 2 bp Het probably null 0.959 03/25/2015
48 569717 UTSW 2610507B11Rik 0.964 R7339 G1 225.01 Y 11 78272384 G A critical splice donor site 1 bp Het probably null 09/13/2019
49 186200 UTSW 2610524H06Rik R1571 G1 220 N 5 114823311 A G critical splice donor site 2 bp Het probably null 05/09/2014
50 52457 APN 2700049A03Rik 1.000 IGL01107 G1 12 71194468 T C critical splice donor site 2 bp Het probably null phenotype 06/21/2013
51 33807 UTSW 2700049A03Rik 1.000 R0220 G1 140 N 12 71148420 T C critical splice donor site 2 bp Het probably null phenotype 05/09/2013
52 610123 UTSW 2700062C07Rik 0.813 R7903 G1 225.01 N 18 24475726 T C critical splice donor site 2 bp Het probably null 12/20/2019
53 615295 UTSW 2700062C07Rik 0.813 R7986 G1 225.01 N 18 24475726 T C critical splice donor site 2 bp Het probably null 12/27/2019
54 489804 UTSW 2810474O19Rik 0.000 R6160 G1 225.01 Y 6 149331507 G A critical splice donor site 1 bp Het probably null 10/10/2017
55 324513 UTSW 2900026A02Rik 0.071 R4329 G1 186 Y 5 113095589 C A critical splice donor site 1 bp Het probably null 0.949 06/24/2015
56 504531 UTSW 3110009E18Rik 0.059 R6229 G1 219.01 Y 1 120171483 G A critical splice donor site 1 bp Het probably null 02/28/2018
57 573787 UTSW 3830403N18Rik 0.063 R7395 G1 128.51 Y X 56138780 G T critical splice donor site 1 bp Het probably null 09/13/2019
58 573866 UTSW 3830403N18Rik 0.063 R7396 G1 188.03 Y X 56138780 G T critical splice donor site 1 bp Het probably null 09/13/2019
59 439494 UTSW 4430402I18Rik 0.134 R4911 G1 225 Y 19 28897503 G A critical splice donor site Het probably benign 0.090 11/02/2016
60 191138 UTSW 4732465J04Rik 0.527 R1717 G1 148 Y 10 95793779 GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCT GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCT critical splice donor site Het probably null 05/14/2014
61 89778 APN 4833420G17Rik 0.000 IGL01531 G1 13 119466958 T A critical splice donor site 2 bp Het probably null 12/03/2013
62 249919 UTSW 4833427G06Rik 0.431 R2444 G1 225 N 9 51099998 A G critical splice donor site 2 bp Het probably null 11/12/2014
63 153057 APN 4833439L19Rik 0.113 IGL01747 G1 13 54556525 A G critical splice donor site 2 bp Het probably null 02/04/2014
64 161756 UTSW 4921504E06Rik 0.053 R1456 G1 225 Y 2 19480920 C T critical splice donor site 1 bp Het probably null 0.976 03/14/2014
65 432623 UTSW 4921507P07Rik 0.078 R5453 G1 225 N 6 50595796 A G critical splice donor site 2 bp Het probably null 10/06/2016
66 527886 UTSW 4921507P07Rik 0.078 R6689 G1 225.01 N 6 50589109 A G critical splice donor site 2 bp Het probably null 07/23/2018
67 274885 UTSW 4921524L21Rik 0.084 R3820 G1 225 Y 18 6630166 G T critical splice donor site 1 bp Het probably null 0.949 04/02/2015
68 455349 UTSW 4921524L21Rik 0.084 R5873 G1 225 N 18 6630167 T A critical splice donor site 2 bp Het probably null 02/10/2017
69 525369 UTSW 4921539E11Rik 0.055 R6634 G1 225.01 Y 4 103236930 C T critical splice donor site 1 bp Het probably null 0.938 06/22/2018
70 50633 APN 4930402H24Rik 0.000 IGL01146 G1 2 130770671 C T critical splice donor site 1 bp Het probably null phenotype 06/21/2013
71 163374 UTSW 4930402H24Rik 0.000 R1485 G1 211 N 2 130748683 A G critical splice donor site 2 bp Het probably null phenotype 03/28/2014
72 530095 UTSW 4930402H24Rik 0.000 R6732 G1 225.01 Y 2 130810820 A G critical splice donor site 2 bp Het probably null 0.950 phenotype 08/01/2018
73 297010 APN 4930415O20Rik 0.149 IGL02524 15 98571125 G A critical splice donor site 1 bp Het probably null 04/16/2015
74 57037 UTSW 4930430A15Rik 0.060 R0645 G1 159 Y 2 111214583 C T critical splice donor site 1 bp Het probably null 0.976 07/11/2013
75 200914 UTSW 4930430A15Rik 0.060 R1464 G1 225 N 2 111225403 A G critical splice donor site 2 bp Het probably null 05/23/2014
76 512672 UTSW 4930430A15Rik 0.060 R6366 G1 225.01 N 2 111169592 A G critical splice donor site 2 bp Het probably null 0.976 04/27/2018
77 542764 UTSW 4930430A15Rik 0.060 R6983 G1 225.01 Y 2 111228250 A G critical splice donor site 2 bp Het probably null 11/28/2018
78 559871 UTSW 4930438A08Rik 0.066 R7195 G1 225.01 N 11 58288416 T C critical splice donor site 2 bp Het probably null 06/26/2019
79 389692 UTSW 4930444P10Rik 0.078 R4999 G1 225 N 1 16068798 A G critical splice donor site 2 bp Het probably null 06/06/2016
80 401005 UTSW 4930447C04Rik 0.214 R5243 G1 225 Y 12 72909769 A T critical splice donor site 2 bp Het probably null 0.949 phenotype 07/06/2016
81 432728 UTSW 4930452B06Rik 0.079 R5455 G1 225 N 14 8536516 A T critical splice donor site 2 bp Het probably null 10/06/2016
82 288146 APN 4930467E23Rik IGL02318 8 19747799 T C critical splice donor site 2 bp Het probably null 04/16/2015
83 556283 UTSW 4930486L24Rik 0.105 PIT4514001 G1 137.01 N 13 60853514 A G critical splice donor site 2 bp Het probably null 06/07/2019
84 251724 UTSW 4930510E17Rik 0.163 R2847 G1 225 N 9 53264789 T C critical splice donor site Het noncoding transcript 12/04/2014
85 162048 UTSW 4930522H14Rik 0.071 R1460 G1 225 Y 4 109531210 A T critical splice donor site 2 bp Het probably null 0.936 03/14/2014
86 382049 UTSW 4930522L14Rik 0.088 R4952 G1 225 Y 5 109739197 A G critical splice donor site 2 bp Het probably null 0.976 04/27/2016
87 396515 UTSW 4930522L14Rik 0.088 R5143 G1 212 N 5 109739198 C T critical splice donor site 1 bp Het probably null 06/21/2016
88 501380 UTSW 4930579C12Rik 0.067 R5756 G1 133 Y 9 89128866 A G critical splice donor site Het noncoding transcript 0.087 12/01/2017
89 234249 UTSW 4930579F01Rik 0.054 R2151 G1 225 Y 3 138176456 A G critical splice donor site 2 bp Het probably null 0.949 10/01/2014
90 54554 UTSW 4930596D02Rik 0.181 R0609 G1 225 N 14 35811461 A T critical splice donor site 2 bp Het probably null 07/11/2013
91 516839 UTSW 4931406P16Rik 0.000 R6477 G1 225.01 Y 7 34257630 A G critical splice donor site 2 bp Het probably null 05/21/2018
92 267531 UTSW 4931409K22Rik 0.137 R3522 G1 225 Y 5 24549626 A G critical splice donor site 2 bp Het probably null 0.976 02/18/2015
93 367659 UTSW 4931409K22Rik 0.137 R4773 G1 225 Y 5 24550598 A G critical splice donor site 2 bp Het probably null 0.948 12/29/2015
94 326435 UTSW 4931414P19Rik 0.085 R4392 G1 225 Y 14 54584978 C T critical splice donor site 1 bp Het probably null 0.949 07/06/2015
95 439685 UTSW 4931423N10Rik 0.074 R5619 G1 225 Y 2 23257005 T C critical splice donor site 2 bp Het probably null 0.976 11/08/2016
96 396289 UTSW 4931429L15Rik 0.000 R5138 G1 225 Y 9 46306821 C A critical splice donor site 1 bp Het probably null 0.976 06/21/2016
97 427931 UTSW 4931429L15Rik 0.000 R5419 G1 225 N 9 46309326 C T critical splice donor site 1 bp Het probably null 09/01/2016
98 307848 UTSW 4932414N04Rik 0.000 R3950 G1 225 N 2 68664403 T C critical splice donor site 2 bp Het probably null 0.976 04/17/2015
99 307917 UTSW 4932414N04Rik 0.000 R3951 G1 225 Y 2 68664403 T C critical splice donor site 2 bp Het probably null 0.976 04/17/2015
100 307973 UTSW 4932414N04Rik 0.000 R3952 G1 225 Y 2 68664403 T C critical splice donor site 2 bp Het probably null 0.976 04/17/2015
[records 1 to 100 of 11537] next >> last >|