Incidental Mutations

1,257 incidental mutations are currently displayed, and affect 465 genes.
0 are Possibly Damaging.
0 are Probably Damaging.
1 are Probably Benign.
1,254 are Probably Null.
0 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 1257] next >> last >| per page Full List
ID question?
Source question?
Gene question?
E-score question?
Stock # question?
Gen question?
Vld question?
Strain question?
Chr question?
Position question?
Mutation question?
Type question?
Exon Dist question?
Zygosity question?
Predicted Effect question?
PPH Score question?
Meta Score question?
MGI Phenotype question?
Posted question?
1 479988 UTSW 2310033P09Rik 0.321 R6025 G1 217.47 N 11 59210313 GC G frame shift Het probably null 06/26/2017
2 511256 UTSW 2810004N23Rik 0.657 FR4342 214.46 N 8 124839833 TT TTATGT frame shift Homo probably null 04/05/2018
3 437139 UTSW 3110002H16Rik 0.649 R5574 G1 217 Y 18 12185006 CTGTGTGTT CTGTGTGTTGTGTGTT frame shift Het probably null phenotype 10/26/2016
4 56364 UTSW 4921517D22Rik 0.083 R0579 G1 212 Y 13 59691598 GCC GC frame shift Het probably null 0.646 07/11/2013
5 61952 UTSW 4921517D22Rik 0.083 R0664 G1 100 Y 13 59691598 GCC GC frame shift Het probably null 0.646 07/30/2013
6 69481 UTSW 4921517D22Rik 0.083 R0757 G1 217 N 13 59691598 GCC GC frame shift Het probably null 0.646 09/30/2013
7 69488 UTSW 4921517D22Rik 0.083 R0758 G1 217 N 13 59691598 GCC GC frame shift Het probably null 0.646 09/30/2013
8 76990 UTSW 4921517D22Rik 0.083 R0777 G1 217 N 13 59691598 GCC GC frame shift Het probably null 0.646 10/16/2013
9 76569 UTSW 4921517D22Rik 0.083 R0779 G1 217 N 13 59691598 GCC GC frame shift Het probably null 0.646 10/16/2013
10 78548 UTSW 4921517D22Rik 0.083 R0814 G1 217 N 13 59691598 GCC GC frame shift Het probably null 0.646 10/16/2013
11 81632 UTSW 4921517D22Rik 0.083 R0870 G1 217 N 13 59691598 GCC GC frame shift Het probably null 0.646 11/08/2013
12 81639 UTSW 4921517D22Rik 0.083 R0872 G1 217 N 13 59691598 GCC GC frame shift Het probably null 0.646 11/08/2013
13 81644 UTSW 4921517D22Rik 0.083 R0873 G1 217 N 13 59691598 GCC GC frame shift Het probably null 0.646 11/08/2013
14 100263 UTSW 4921517D22Rik 0.083 R1062 G1 217 N 13 59691598 GCC GC frame shift Het probably null 0.646 01/15/2014
15 85947 UTSW 4921517D22Rik 0.083 R1064 G1 217 N 13 59691598 GCC GC frame shift Het probably null 0.646 11/18/2013
16 165230 UTSW 4921517D22Rik 0.083 R1149 G1 217 N 13 59691598 GCC GC frame shift Het probably null 0.646 03/28/2014
17 101604 UTSW 4921517D22Rik 0.083 R1151 G1 217 N 13 59691598 GCC GC frame shift Het probably null 0.646 01/15/2014
18 101621 UTSW 4921517D22Rik 0.083 R1152 G1 217 N 13 59691598 GCC GC frame shift Het probably null 0.646 01/15/2014
19 164807 UTSW 4921517D22Rik 0.083 R1207 G1 217 N 13 59691598 GCC GC frame shift Het probably null 0.646 03/28/2014
20 150657 UTSW 4921517D22Rik 0.083 R1285 G1 217 N 13 59691598 GCC GC frame shift Het probably null 0.646 01/29/2014
21 156968 UTSW 4921517D22Rik 0.083 R1339 G1 217 N 13 59691598 GCC GC frame shift Het probably null 0.646 02/11/2014
22 156230 UTSW 4921517D22Rik 0.083 R1358 G1 217 N 13 59691598 GCC GC frame shift Het probably null 0.646 02/11/2014
23 156371 UTSW 4921517D22Rik 0.083 R1359 G1 217 N 13 59691598 GCC GC frame shift Het probably null 0.646 02/11/2014
24 156376 UTSW 4921517D22Rik 0.083 R1360 G1 217 N 13 59691598 GCC GC frame shift Het probably null 0.646 02/11/2014
25 156378 UTSW 4921517D22Rik 0.083 R1361 G1 217 N 13 59691598 GCCGACC GCGACC frame shift Het probably null 02/11/2014
26 188366 UTSW 4921517D22Rik 0.083 R1679 G1 217 Y 13 59691598 GCC GC frame shift Het probably null 0.646 05/09/2014
27 206415 UTSW 4930544D05Rik 0.080 E0370 G1 209 Y 11 70616426 TGCAGCGACTGGACGGCGGCA TGCA frame shift Het probably null phenotype 06/23/2014
28 262166 UTSW 4930556J24Rik 0.170 T0975 G3 211 N 714 11 3937945 TAA TAAA frame shift Het probably null 02/04/2015
29 511505 UTSW 4932415D10Rik 0.134 FR4449 190.46 N 10 82285469 TTCAGT TT frame shift Homo probably null 04/05/2018
31 429653 UTSW A430005L14Rik 0.087 R5396 G1 188 N 4 153960953 GCC G frame shift Het probably null 09/06/2016
32 525188 UTSW A430033K04Rik 0.195 R6600 G1 217.47 N 5 138647448 ACGC ACGCGC frame shift Het probably null 06/22/2018
33 216562 UTSW Abca1 0.544 R1945 G1 117 N 4 53061509 ACGTCTTCACCAGGTAATC AC frame shift Het probably null phenotype 08/01/2014
34 389233 UTSW Abca1 0.544 R5022 G1 217 Y 4 53041570 TCGACTGC T frame shift Het probably null phenotype 06/06/2016
35 398917 UTSW Abca13 0.153 R5173 G1 217 Y 11 9682032 AC A frame shift Het probably null 0.602 phenotype 07/06/2016
36 66431 UTSW Abca4 0.000 K7894 217 N 468 3 122147868 C CAA frame shift Het probably null phenotype 08/19/2013
37 235371 UTSW Abca6 0.092 R2164 G1 167 N 11 110210193 CTGTAGGAAATCTTCAATGT CTGT frame shift Het probably null phenotype 10/01/2014
38 246861 UTSW Abcb9 0.210 R2355 G1 217 N 5 124077305 CGG CG frame shift Het probably null 0.609 phenotype 10/30/2014
39 247005 UTSW Abcb9 0.210 R2358 G1 202 Y 5 124077305 CGG CG frame shift Het probably null 0.609 phenotype 10/30/2014
40 219837 UTSW Abcg5 0.230 R1970 G1 192 Y 17 84673602 AATCATTTG AG frame shift Het probably null phenotype 08/25/2014
41 194791 UTSW Acaca 1.000 R1755 G1 217 N 11 84276564 AC A frame shift Het probably null phenotype 05/23/2014
42 195712 UTSW Acacb 0.000 R1783 G1 139 N 5 114209767 TGGGG TGGG frame shift Het probably null phenotype 05/23/2014
43 196019 UTSW Acacb 0.000 R1784 G1 165 N 5 114209767 TGGGG TGGG frame shift Het probably null phenotype 05/23/2014
44 233377 UTSW Acacb 0.000 R2132 G1 147 Y 5 114209767 TGGGG TGGG frame shift Het probably null phenotype 10/01/2014
45 233518 UTSW Acacb 0.000 R2133 G1 143 N 5 114209767 TGGGG TGGG frame shift Het probably null phenotype 10/01/2014
46 402455 UTSW Acin1 0.936 R5223 G1 217 N 14 54642941 CCGC CC frame shift Het probably null phenotype 07/22/2016
47 428024 UTSW Actn3 0.000 R5420 G1 169 Y 19 4865344 TGCGCAGC T frame shift Het probably null 0.620 phenotype 09/01/2016
48 187972 UTSW Adamtsl2 1.000 R1675 G1 154 N 2 27082485 GC G frame shift Het probably null phenotype 05/09/2014
49 250464 UTSW Adgrv1 0.000 R2432 G1 217 Y 13 81540132 GA GAA frame shift Het probably null 0.627 phenotype 11/12/2014
50 311320 UTSW Adgrv1 0.000 R4002 G1 217 Y 13 81540132 GA GAA frame shift Het probably null 0.627 phenotype 04/29/2015
51 311360 UTSW Adgrv1 0.000 R4003 G1 217 Y 13 81540132 GA GAA frame shift Het probably null 0.627 phenotype 04/29/2015
52 349294 UTSW Adora2b 0.000 R4632 G1 217 N 11 62265382 TGGACCACTCCAGGACCACTC TGGACCACTC frame shift Het probably null phenotype 10/08/2015
53 274551 UTSW Aebp2 1.000 R3805 G1 217 Y 6 140643949 GCGGCC GCGGCCGGCC frame shift Het probably null phenotype 04/02/2015
54 65783 UTSW Aff2 0.101 R0190 G1 101 N X 69849105 CA CAAA frame shift Het probably null phenotype 08/19/2013
55 225965 UTSW Agtpbp1 0.635 R2001 G1 217 N 13 59475803 TGAAGATGCATCTTGAGAAGA TGAAGA frame shift Het probably null phenotype 08/25/2014
56 446281 UTSW AI429214 0.054 R5766 G1 217 N 8 36994229 TCCCTGATGAAC TC frame shift Het probably null 11/21/2016
57 446330 UTSW AI429214 0.054 R5767 G1 217 Y 8 36994229 TCCCTGATGAAC TC frame shift Het probably null 11/21/2016
58 392332 UTSW Aim1l 0.831 R4680 G1 201 Y 4 134072718 CTTCCAGAGCCATGGACCCATCTTTTCCA CTTCCA frame shift Het probably null 0.641 06/15/2016
59 406132 UTSW Aim1l 0.831 R4681 G1 205 Y 4 134072718 CTTCCAGAGCCATGGACCCATCTTTTCCA CTTCCA frame shift Het probably null 0.641 07/28/2016
60 397267 UTSW Aim1l 0.831 R4682 G1 217 Y 4 134072718 CTTCCAGAGCCATGGACCCATCTTTTCCA CTTCCA frame shift Het probably null 0.641 07/05/2016
61 353690 UTSW Akap6 0.719 R4686 G1 217 Y 12 52887623 CA C frame shift Het probably null phenotype 10/21/2015
62 366647 UTSW Akap6 0.719 R4782 G1 217 N 12 52887623 CA C frame shift Het probably null phenotype 12/29/2015
63 231826 UTSW Alb 0.123 R2092 G1 217 N 5 90463983 G GA frame shift Het probably null phenotype 09/18/2014
64 511948 UTSW Alg1 0.240 FR4976 214.97 N 16 5244561 GCTCACTCAC GCTCAC frame shift Homo probably null phenotype 04/05/2018
65 500181 UTSW Amh 0.498 R1195 G1 121 N 10 80805585 AGCGCCTTGG AG frame shift Het probably null phenotype 12/01/2017
66 193424 UTSW Amh 0.498 R1750 G1 122 N 10 80805585 AGCGCCTTGG AG frame shift Het probably null phenotype 05/23/2014
67 194304 UTSW Amh 0.498 R1765 G1 107 Y 10 80805585 AGCGCCTTGG AG frame shift Het probably null phenotype 05/23/2014
68 224579 UTSW Amh 0.498 R1998 G1 131 N 10 80805585 AGCGCCTTGG AG frame shift Het probably null phenotype 08/25/2014
69 459145 UTSW Amotl2 0.151 Z1088 217 N 9 102723698 TCC TC frame shift Het probably null phenotype 02/27/2017
70 458327 UTSW Ankrd16 0.178 Z1088 217 N 2 11779818 CCTCCGGTACTT C frame shift Het probably null 02/27/2017
71 511216 UTSW Ankrd35 0.108 FR4342 113.47 N 3 96683515 TCCCC TCCC frame shift Het probably null 04/05/2018
72 446097 UTSW Ankrd60 0.314 R5763 G1 217 Y 2 173578089 TGGCCACGCGG TGG frame shift Het probably null 0.646 11/21/2016
73 447998 UTSW Ankrd60 0.314 R5786 G1 217 N 2 173578089 TGGCCACGCGG TGG frame shift Het probably null 0.646 12/15/2016
74 448064 UTSW Ankrd60 0.314 R5787 G1 217 N 2 173578089 TGGCCACGCGG TGG frame shift Het probably null 0.646 12/15/2016
75 448130 UTSW Ankrd60 0.314 R5788 G1 217 Y 2 173578089 TGGCCACGCGG TGG frame shift Het probably null 0.646 12/15/2016
76 164312 UTSW Anxa2 0.000 R1480 G1 217 N 9 69489754 TCCC TCC frame shift Het probably null 0.638 phenotype 03/28/2014
77 164452 UTSW Anxa2 0.000 R1482 G1 178 N 9 69489754 TCCC TCC frame shift Het probably null 0.638 phenotype 03/28/2014
78 176680 UTSW Anxa2 0.000 R1609 G1 152 Y 9 69489754 TCCC TCC frame shift Het probably null 0.638 phenotype 04/24/2014
79 176743 UTSW Anxa2 0.000 R1610 G1 217 N 9 69489754 TCCC TCC frame shift Het probably null 0.638 phenotype 04/24/2014
80 187712 UTSW Anxa2 0.000 R1672 G1 217 N 9 69489754 TCCC TCC frame shift Het probably null 0.638 phenotype 05/09/2014
81 192244 UTSW Anxa2 0.000 R1696 G1 158 N 9 69489754 TCCC TCC frame shift Het probably null 0.638 phenotype 05/14/2014
82 209357 UTSW Anxa2 0.000 R1884 G1 217 Y 9 69489754 TCCC TCC frame shift Het probably null 0.638 phenotype 06/30/2014
83 233843 UTSW Anxa2 0.000 R2146 G1 102 Y 9 69489754 TCCC TCC frame shift Het probably null 0.638 phenotype 10/01/2014
84 234024 UTSW Anxa2 0.000 R2148 G1 217 N 9 69489754 TCCC TCC frame shift Het probably null 0.638 phenotype 10/01/2014
85 234120 UTSW Anxa2 0.000 R2149 G1 174 N 9 69489754 TCCC TCC frame shift Het probably null 0.638 phenotype 10/01/2014
86 234203 UTSW Anxa2 0.000 R2150 G1 212 Y 9 69489754 TCCC TCC frame shift Het probably null 0.638 phenotype 10/01/2014
87 366988 UTSW Ap3d1 0.604 R4785 G1 106 N 10 80712778 TTCTCTCTCTCTCTCTCT TTCTCTCTCTCTCTCT frame shift Het probably null phenotype 12/29/2015
88 374763 UTSW Ap3d1 0.604 R4864 G1 103 Y 10 80712778 TTCTCTCTCTCTCTCTCT TTCTCTCTCTCTCTCT frame shift Het probably null phenotype 03/17/2016
89 511053 UTSW Apol6 0.058 FR4304 217.54 N 15 77051436 TTGT TTGTCTGT frame shift Het probably null phenotype 04/05/2018
90 512117 UTSW Apol6 0.058 FR4548 214.46 N 15 77051445 T TGTTA frame shift Homo probably null phenotype 04/05/2018
91 511413 UTSW Apol6 0.058 FR4589 217.47 N 15 77051438 GTTT GTTTTTTT frame shift Het probably null phenotype 04/05/2018
92 511733 UTSW Apol6 0.058 FR4737 214.46 N 15 77051442 GTTT GTTTCTTT frame shift Homo probably null phenotype 04/05/2018
93 276418 UTSW Arfgef1 0.823 R3863 G1 217 N 1 10142586 CAGAG CAG frame shift Het probably null phenotype 04/06/2015
94 307772 UTSW Arfgef1 0.823 R3948 G1 217 Y 1 10142586 CAGAG CAG frame shift Het probably null phenotype 04/17/2015
95 307804 UTSW Arfgef1 0.823 R3949 G1 217 Y 1 10142586 CAGAG CAG frame shift Het probably null phenotype 04/17/2015
96 56402 UTSW Arhgap23 0.293 R0580 G1 107 Y 11 97446536 AGAGGAGGAGGAGGAGG AGAGGAGGAGGAGG frame shift Het probably null phenotype 07/11/2013
97 480795 UTSW Arhgap44 0.160 R6000 G1 217.47 Y 11 65032084 CTGCT CTGCTTGCT frame shift Het probably null 0.618 06/26/2017
98 480843 UTSW Arhgap44 0.160 R6001 G1 217.47 N 11 65032084 CTGCT CTGCTTGCT frame shift Het probably null 0.618 06/26/2017
99 483311 UTSW Arhgap44 0.160 R6046 G1 217.47 Y 11 65032084 CTGCT CTGCTTGCT frame shift Het probably null 0.618 07/14/2017
100 484048 UTSW Arhgap44 0.160 R6066 G1 217.47 N 11 65032084 CTGCT CTGCTTGCT frame shift Het probably null 0.618 07/14/2017
[records 1 to 100 of 1257] next >> last >|