Incidental Mutations

3,724 incidental mutations are currently displayed, and affect 2,606 genes.
13 are Possibly Damaging.
15 are Probably Damaging.
2,390 are Probably Benign.
1,181 are Probably Null.
26 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 3724] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 531109 UTSW 0610010F05Rik 0.192 R6758 G1 97.01 N 11 23588475 T C intron 160 bp Het probably null 08/01/2018
2 462477 UTSW 0610037L13Rik 0.223 R5940 G1 225 Y 4 107893288 A G intron Het probably benign 0.064 02/28/2017
3 401247 UTSW 1110032A03Rik 0.000 R5258 G1 150 Y 9 50764333 T C intron Het probably benign 07/06/2016
4 397644 UTSW 1110059E24Rik 0.090 R5182 G1 225 Y 19 21630765 M1T A G intron Het probably null 0.595 07/06/2016
5 457914 UTSW 1520401A03Rik 0.115 R5459 G1 225 N 17 23711843 C T intron Het probably benign 02/16/2017
6 266055 UTSW 1700001O22Rik 0.022 R2082 G1 225 N 2 30796379 T A intron 22 bp Het probably null 02/05/2015
7 478174 UTSW 1700007G11Rik 0.154 LCD18 G1 999 Y 5 98707508 G A intron Het probably benign 05/26/2017
8 81249 UTSW 1700007G11Rik 0.154 R0962 G1 225 Y 5 98566561 T C intron Het probably benign 11/07/2013
9 217552 UTSW 1700007G11Rik 0.154 R1954 G1 225 Y 5 98566753 A T intron Het probably benign 08/01/2014
10 431748 UTSW 1700010L04Rik 0.097 R5524 G1 225 Y 7 82853942 T A intron Het noncoding transcript 10/05/2016
11 441217 UTSW 1700010L04Rik 0.097 R5647 G1 225 Y 7 82856398 T C intron Het noncoding transcript 11/08/2016
12 266065 UTSW 1700013D24Rik 0.105 R2146 G1 225 N 6 124347844 A T intron Het probably null 02/05/2015
13 422361 UTSW 1700017D01Rik 0.068 R5341 G1 225 Y 19 11110381 T C intron Het probably benign 08/04/2016
14 395830 UTSW 1700021A07Rik 0.122 R5095 G1 225 Y 10 21425593 G C intron Het noncoding transcript 0.058 06/21/2016
15 356358 UTSW 1700028I16Rik 0.229 R3836 G1 145 Y 10 82812385 A G intron Het noncoding transcript 11/06/2015
16 359749 UTSW 1700028I16Rik 0.229 R3837 G1 204 Y 10 82812385 A G intron Het noncoding transcript 12/16/2015
17 359664 UTSW 1700028I16Rik 0.229 R3839 G1 225 Y 10 82812385 A G intron Het noncoding transcript 11/12/2015
18 379318 UTSW 1700030C10Rik 0.265 R4909 G1 161 Y 12 20815088 A T intron Het noncoding transcript 04/15/2016
19 539519 UTSW 1700086D15Rik 0.117 R6919 G1 225.01 N 11 65152530 A G intron Het probably benign 11/06/2018
20 324948 UTSW 2200002D01Rik 0.085 R4362 G1 225 Y 7 29248262 C T intron Het probably benign 07/06/2015
21 344974 UTSW 2210408I21Rik 0.359 R4614 G1 225 Y 13 77254256 T G intron 39 bp Het probably null 0.624 09/25/2015
22 64763 UTSW 2310016G11Rik 0.205 R0021 G1 176 Y 7 44677196 A G intron Het noncoding transcript 0.112 08/06/2013
23 325296 UTSW 2310016G11Rik 0.205 R4380 G1 225 Y 7 44677156 T C intron Het noncoding transcript 0.107 07/06/2015
24 271571 UTSW 2310033P09Rik 0.335 R1476 G1 167 Y 11 59208702 A G intron Het probably benign 0.057 03/23/2015
25 428240 UTSW 2310035C23Rik 0.473 R5435 G1 120 Y 1 105741250 T A intron Het probably benign 09/01/2016
26 451567 UTSW 2310035C23Rik 0.473 R5734 G1 225 Y 1 105703883 T C intron Het probably benign 0.018 01/03/2017
27 352707 UTSW 2410089E03Rik 1.000 R4659 G1 225 Y 15 8216276 G T intron Het probably benign 0.064 phenotype 10/08/2015
28 157148 UTSW 2610507B11Rik 0.960 R0244 G1 105 N 11 78286491 T A intron Het probably null 02/14/2014
29 368375 UTSW 2610507B11Rik 0.960 R4196 G1 225 Y 11 78263556 A G intron Het probably benign 02/02/2016
30 324392 UTSW 2700081O15Rik 0.277 R4326 G1 197 Y 19 7421226 A G intron Het probably benign 0.068 06/24/2015
31 397274 UTSW 2700081O15Rik 0.277 R4329 G1 74 Y 19 7421226 A G intron Het probably benign 0.068 07/05/2016
32 453396 UTSW 2900041M22Rik 0.225 IGL03055 G1 106 Y 11 117612246 T A intron Het noncoding transcript 0.061 02/03/2017
33 374169 UTSW 3110002H16Rik 0.665 R4826 G1 210 Y 18 12185779 G T intron Het probably benign 0.050 phenotype 03/01/2016
34 430948 UTSW 3110002H16Rik 0.665 R5506 G1 225 Y 18 12188956 A G intron Het probably benign 0.064 phenotype 10/05/2016
35 181470 APN 4732465J04Rik 0.261 IGL01958 G1 10 95793797 I29T T C intron Het probably damaging 0.985 05/07/2014
36 65757 UTSW 4732465J04Rik 0.261 R0080 G1 133 Y 10 95794578 GATCTATCTATCTATCTATCTATCTATCTATCTATCTATC GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATC intron Het probably null 08/19/2013
37 65771 UTSW 4732465J04Rik 0.261 R0164 G1 161 Y 10 95794578 GATCTATCTATCTATCTATCTATCTATCTATCTATCTATC GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATC intron Het probably null 08/19/2013
38 191138 UTSW 4732465J04Rik 0.261 R1717 G1 148 Y 10 95793779 GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCT GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCT intron Het probably null 05/14/2014
39 383829 UTSW 4833420G17Rik 0.197 R4964 G1 225 Y 13 119474221 T C intron Het probably benign 0.062 04/27/2016
40 384042 UTSW 4833420G17Rik 0.197 R4966 G1 225 Y 13 119474221 T C intron Het probably benign 0.062 04/27/2016
41 387950 UTSW 4833420G17Rik 0.197 R5093 G1 225 Y 13 119474037 C T intron Het probably benign 06/06/2016
42 384139 UTSW 4930447C04Rik 0.326 R4967 G1 225 Y 12 72909728 Y199* A T intron Het probably null 0.613 phenotype 04/27/2016
43 535655 UTSW 4930503L19Rik 0.116 R6381 G1 220.01 Y 18 70467717 M365L T A intron Het probably damaging 1.000 10/01/2018
44 529349 UTSW 4930511M06Rik PIT1430001 G1 100 Y 18 57384169 T C intron Het probably benign 07/31/2018
45 44414 UTSW 4930519F16Rik H8562 G3 225 Y 604 X 103255857 A T intron Het noncoding transcript 06/11/2013
46 359705 UTSW 4930544M13Rik 0.306 R4036 G1 225 Y 13 114607669 T C intron Het noncoding transcript 0.040 12/02/2015
47 321609 UTSW 4930555F03Rik 0.180 R4163 G1 225 Y 8 49495496 G A intron Het noncoding transcript 0.103 06/12/2015
48 535677 UTSW 4930579F01Rik 0.048 R6862 G1 225.01 N 3 138186188 C T intron Het probably benign 10/18/2018
49 265937 UTSW 4931422A03Rik 0.160 R1722 G1 225 N 2 103993928 A T intron Het probably null 02/05/2015
50 368379 UTSW 4932414N04Rik 0.083 R4153 G1 66 Y 2 68668597 A T intron Het probably benign 02/03/2016
51 348502 UTSW 4932438A13Rik 0.921 R4672 G1 225 Y 3 36889990 *330W A G intron Het probably null 0.647 phenotype 10/08/2015
52 453345 UTSW 4932438A13Rik 0.921 R5030 G1 225 Y 3 36943399 A G intron Het probably benign 0.065 phenotype 02/01/2017
53 394507 UTSW 4932438A13Rik 0.921 R5049 G1 225 Y 3 37040506 T A intron Het probably benign 0.063 phenotype 06/15/2016
54 358160 UTSW 4933407L21Rik 0.078 R4743 G1 131 Y 1 85931251 A G intron Het probably benign 0.055 11/11/2015
55 181129 APN 6030469F06Rik 0.192 IGL01957 G1 12 31185043 T C intron Het noncoding transcript 05/07/2014
56 36681 UTSW 6030469F06Rik 0.192 R0411 G1 180 Y 12 31184731 A T intron Het noncoding transcript 0.658 05/09/2013
57 200982 UTSW 6030469F06Rik 0.192 R1464 G1 225 N 12 31184915 A G intron Het noncoding transcript 05/23/2014
58 267862 UTSW 6030469F06Rik 0.192 R3424 G1 225 N 12 31184633 G T intron Het noncoding transcript 02/18/2015
59 326376 UTSW 6030469F06Rik 0.192 R4391 G1 123 N 12 31184623 A T intron Het noncoding transcript 07/06/2015
60 431766 UTSW 6030469F06Rik 0.192 R5524 G1 225 Y 12 31184863 A G intron Het noncoding transcript 0.068 10/05/2016
61 532555 UTSW 9230113P08Rik 0.136 R6790 G1 225.01 N 9 35908831 G T intron Het probably benign 08/29/2018
62 376865 UTSW 9530053A07Rik 0.112 R4876 G1 225 Y 7 28142800 A T intron Het probably benign 03/17/2016
63 438082 UTSW 9530053A07Rik 0.112 R5613 G1 225 Y 7 28142878 A T intron Het probably benign 10/26/2016
64 484581 UTSW 9530077C05Rik 0.178 LCD18 G1 2735.94 Y 9 22442083 N intron Het probably benign 0.052 08/15/2017
65 404600 UTSW 9930021J03Rik 0.281 R5306 G1 225 Y 19 29729830 A G intron Het probably benign 0.615 07/22/2016
66 490322 UTSW 9930111J21Rik2 0.289 R6169 G1 225.01 N 11 49019261 A T intron 40271 bp Het probably null 10/10/2017
67 532970 UTSW A2m 0.000 R6795 G1 138.01 N 6 121648322 T A intron 146 bp Het probably null phenotype 08/29/2018
68 531229 UTSW A2ml1 0.263 R6327 G1 129.01 Y 6 128558692 T C intron Het probably null 08/07/2018
69 51713 APN A330008L17Rik 0.085 IGL01067 G1 8 99421954 T C intron Het noncoding transcript 06/21/2013
70 284792 APN A330008L17Rik 0.085 IGL02214 8 99421758 T A intron Het noncoding transcript 04/16/2015
71 419571 APN A330008L17Rik 0.085 IGL03348 8 99421692 A C intron Het noncoding transcript 08/02/2016
72 478194 UTSW A330008L17Rik 0.085 LCD18 G1 999 Y 8 99723425 A G intron Het noncoding transcript 05/26/2017
73 23719 UTSW A330008L17Rik 0.085 R0173 G1 196 Y 8 99421654 G A intron Het noncoding transcript 04/16/2013
74 194863 UTSW A330008L17Rik 0.085 R1756 G1 225 Y 8 99421882 C A intron Het noncoding transcript 05/23/2014
75 273895 UTSW A330008L17Rik 0.085 R3829 G1 225 Y 8 99421757 A G intron Het noncoding transcript 04/02/2015
76 33254 UTSW A530053G22Rik 0.140 R0105 G1 225 Y 6 60402152 T C intron Het noncoding transcript 0.124 05/09/2013
77 356793 UTSW A530053G22Rik 0.140 R4760 G1 225 Y 6 60402101 A G intron Het noncoding transcript 0.054 11/11/2015
78 301499 APN A730018C14Rik 0.180 IGL02635 12 112415152 A C intron Het noncoding transcript 04/16/2015
79 93737 UTSW A730018C14Rik 0.180 R0106 G1 25 Y 12 112415194 A T intron Het noncoding transcript 0.054 01/02/2014
80 65965 UTSW A730018C14Rik 0.180 R0233 G1 214 N 12 112415430 A C intron Het noncoding transcript 0.052 08/19/2013
81 163490 UTSW A730018C14Rik 0.180 R1486 G1 225 N 12 112415695 T C intron Het noncoding transcript 03/28/2014
82 163769 UTSW A730018C14Rik 0.180 R1491 G1 225 N 12 112415055 T A intron Het noncoding transcript 03/28/2014
83 172050 UTSW A730018C14Rik 0.180 R1544 G1 225 Y 12 112415490 A G intron Het noncoding transcript 0.102 04/13/2014
84 325911 UTSW A730018C14Rik 0.180 R4369 G1 225 N 12 112415614 T C intron Het noncoding transcript 07/06/2015
85 366438 UTSW A730018C14Rik 0.180 R4780 G1 225 Y 12 112415635 A G intron Het noncoding transcript 0.061 12/21/2015
86 454189 UTSW A730018C14Rik 0.180 R5866 G1 225 Y 12 112415038 T C intron Het noncoding transcript 0.130 02/10/2017
87 351344 UTSW A830018L16Rik 0.137 R4652 G1 182 Y 1 11537342 C A intron Het probably benign phenotype 10/08/2015
88 70889 UTSW A930003A15Rik 0.175 R0744 G1 225 Y 16 19883872 T C intron Het noncoding transcript 0.061 09/30/2013
89 77954 UTSW A930003A15Rik 0.175 R0836 G1 225 Y 16 19883872 T C intron Het noncoding transcript 0.061 10/16/2013
90 533543 UTSW A930009A15Rik 0.075 R6805 G1 225.01 N 10 115579905 G T intron Het probably benign 09/12/2018
91 343283 UTSW A930011G23Rik 0.158 R4565 G1 225 Y 5 99227947 T C intron Het probably benign 09/24/2015
92 424834 UTSW Aadac 0.104 R5383 G1 219 Y 3 60036075 T C intron Het probably benign phenotype 08/04/2016
93 478219 UTSW Aaed1 0.137 LCD18 G1 119 Y 13 64287285 G A intron Het probably benign 05/26/2017
94 314437 UTSW Aamp 0.968 R4112 G1 225 Y 1 74281227 A G intron Het probably benign 0.071 phenotype 05/14/2015
95 265992 UTSW Aarsd1 0.378 R1909 G1 225 N 11 101410231 A C intron Het probably null 02/05/2015
96 518336 UTSW Abat 0.130 R6426 G1 225.01 Y 16 8602436 C T intron Het probably benign phenotype 05/24/2018
97 518377 UTSW Abat 0.130 R6427 G1 225.01 Y 16 8602436 C T intron Het probably benign phenotype 05/24/2018
98 516245 UTSW Abca4 0.000 R6405 G1 198.01 N 3 122173662 A G intron Het probably null phenotype 05/04/2018
99 530570 UTSW Abca4 0.000 R6747 G1 216.01 N 3 122126313 C T intron 53 bp Het probably null phenotype 08/01/2018
100 388339 UTSW Abca5 0.172 R5066 G1 225 Y 11 110309350 A T intron Het probably benign 0.136 phenotype 06/06/2016
[records 1 to 100 of 3724] next >> last >|