Incidental Mutations

1,681 incidental mutations are currently displayed, and affect 208 genes.
0 are Possibly Damaging.
0 are Probably Damaging.
1,681 are Probably Benign.
0 are Probably Null.
0 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 1681] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 207681 UTSW 1110038F14Rik R1845 G1 131 N 15 76949663 CGGG CGGGGGG small insertion Het probably benign 06/23/2014
2 313366 UTSW 1110038F14Rik R4023 G1 153 N 15 76949663 CGGG CGGGGGG small insertion Het probably benign 04/30/2015
3 510963 UTSW 4930402H24Rik 0.000 FR4304 198.47 N 2 130770748 TCC TCCCCC small insertion Het probably benign phenotype 04/05/2018
4 511206 UTSW 4930402H24Rik 0.000 FR4342 156.47 N 2 130770742 TCC TCCCCC small insertion Het probably benign phenotype 04/05/2018
5 511319 UTSW 4930402H24Rik 0.000 FR4589 203.47 N 2 130770745 TCC TCCCCC small insertion Het probably benign phenotype 04/05/2018
6 511320 UTSW 4930402H24Rik 0.000 FR4589 142.47 N 2 130770752 CC CCTGC small insertion Het probably benign phenotype 04/05/2018
7 511589 UTSW 4930402H24Rik 0.000 FR4737 145.47 N 2 130770752 CC CCTGC small insertion Het probably benign phenotype 04/05/2018
8 511807 UTSW 4930402H24Rik 0.000 FR4976 150.47 N 2 130770739 TCC TCCCCC small insertion Het probably benign phenotype 04/05/2018
9 511808 UTSW 4930402H24Rik 0.000 FR4976 147.47 N 2 130770742 TCC TCCACC small insertion Het probably benign phenotype 04/05/2018
10 511809 UTSW 4930402H24Rik 0.000 FR4976 135.47 N 2 130770753 C CTCG small insertion Het probably benign phenotype 04/05/2018
11 604181 UTSW 4930402H24Rik 0.000 RF027 G1 191.47 N 2 130770744 CTC CTCGTC small insertion Het probably benign phenotype 12/04/2019
12 604771 UTSW 4930432K21Rik 0.077 RF040 G1 214.53 N 8 84167575 TG TGTCAGGGCAGCAGCAG small insertion Het probably benign 12/04/2019
13 512078 UTSW 4932415D10Rik 0.069 FR4548 214.46 N 10 82290996 G GTCATTA small insertion Homo probably benign 04/05/2018
14 603631 UTSW 4932415D10Rik 0.069 RF017 G1 214.46 N 10 82290992 AA AACTGTCA small insertion Het probably benign 12/04/2019
15 605244 UTSW 4932415D10Rik 0.069 RF055 G1 214.46 N 10 82290993 AATG AATGTCAATG small insertion Het probably benign 12/04/2019
16 156747 UTSW 4933415A04Rik R1332 G1 155 N 11 43587429 T TNNNNNNNNNNNNNNNNNN small insertion Het probably benign 02/11/2014
17 602747 UTSW 5430401F13Rik 0.065 RF005 G1 167.47 N 6 131552884 AGAAAGGAAAAGGTGGCCAG AGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG small insertion Het probably benign 12/04/2019
18 603405 UTSW 5430401F13Rik 0.065 RF014 G1 217.47 N 6 131552857 AGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG AGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG small insertion Het probably benign 12/04/2019
19 603471 UTSW 5430401F13Rik 0.065 RF015 G1 217.47 N 6 131552856 CAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG CAGAAAGGAAAAGGTGGCCAGCAAAAAAAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG small insertion Het probably benign 12/04/2019
20 603472 UTSW 5430401F13Rik 0.065 RF015 G1 217.47 N 6 131552859 AAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG AAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG small insertion Het probably benign 12/04/2019
21 603473 UTSW 5430401F13Rik 0.065 RF015 G1 217.47 N 6 131552861 AGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG AGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG small insertion Het probably benign 12/04/2019
22 603991 UTSW 5430401F13Rik 0.065 RF023 G1 217.47 N 6 131552855 ACAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG ACAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG small insertion Het probably benign 12/04/2019
23 603992 UTSW 5430401F13Rik 0.065 RF023 G1 217.47 N 6 131552878 AAAAACAGAAAGGAAAAGGTGGCCAG AAAAACAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG small insertion Het probably benign 12/04/2019
24 604271 UTSW 5430401F13Rik 0.065 RF029 G1 148.47 N 6 131552895 GGTGGCCAG GGTGGCCAGCAAAAACAGAAAGGAAAAAGTGGCCAG small insertion Het probably benign 12/04/2019
25 604625 UTSW 5430401F13Rik 0.065 RF037 G1 172.47 N 6 131552887 AAGGAAAAGGTGGCCAG AAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG small insertion Het probably benign 12/04/2019
26 604626 UTSW 5430401F13Rik 0.065 RF037 G1 172.47 N 6 131552888 AGGAAAAGGTGGCCAG AGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG small insertion Het probably benign 12/04/2019
27 604818 UTSW 5430401F13Rik 0.065 RF041 G1 217.47 N 6 131552894 AGGTGGCCAG AGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG small insertion Het probably benign 12/04/2019
28 604816 UTSW 5430401F13Rik 0.065 RF041 G1 217.47 N 6 131552873 CCAGCAAAAACAGAAAGGAAAAGG CCAGCAAAAACAGAAAGGAAAAGGAGGCCAGCAAAAACAGAAAGGAAAAGG small insertion Het probably benign 12/04/2019
29 604817 UTSW 5430401F13Rik 0.065 RF041 G1 185.47 N 6 131552892 AAAGGTGGC AAAGGTGGCAAGCAAAAACAGAAAGGAGAAGGTGGC small insertion Het probably benign 12/04/2019
30 604871 UTSW 5430401F13Rik 0.065 RF042 G1 176.47 N 6 131552886 AAAGGAAAAGGTGGCCAG AAAGGAAAAGGTGGCCAGCAAAAACAGGAAGGAAAAGGTGGCCAG small insertion Het probably benign 12/04/2019
31 605327 UTSW 5430401F13Rik 0.065 RF058 G1 160.47 N 6 131552887 AAGGAAAAGGTGGCCAG AAGGAAAAGGTGGCCAGCAAAAACAGAGAGGAAAAGGTGGCCAG small insertion Het probably benign 12/04/2019
32 605328 UTSW 5430401F13Rik 0.065 RF058 G1 197.47 N 6 131552901 CAG CAGCAAAAACAGAAAGGAAAAGGTGGCCAG small insertion Het probably benign 12/04/2019
33 605460 UTSW 5430401F13Rik 0.065 RF063 G1 217.47 N 6 131552883 CAGAAAGGAAAAGGTGGCCAG CAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG small insertion Het probably benign 12/04/2019
34 605461 UTSW 5430401F13Rik 0.065 RF063 G1 217.47 N 6 131552884 AGAAAGGAAAAGGTGGCCAG AGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG small insertion Het probably benign 12/04/2019
35 602474 UTSW A030005L19Rik RF001 G1 185.47 N 1 82913590 G GTGGCTGCTA small insertion Het probably benign 12/04/2019
36 602729 UTSW A030005L19Rik RF005 G1 214.46 N 1 82913585 CTGCTG CTGCTGTGGATGCTG small insertion Het probably benign 12/04/2019
37 603178 UTSW A030005L19Rik RF011 G1 214.97 N 1 82913569 GTGGTGGCTG GTGGTGGCTGTGGTGGCTG small insertion Het probably benign 12/04/2019
38 603179 UTSW A030005L19Rik RF011 G1 217.68 N 1 82913573 TGGCTGCTG TGGCTGCTGGGGCTGCTG small insertion Het probably benign 12/04/2019
39 603180 UTSW A030005L19Rik RF011 G1 217.48 N 1 82913586 TGCTG TGCTGTGGCGGCTG small insertion Het probably benign 12/04/2019
40 603516 UTSW A030005L19Rik RF016 G1 214.48 N 1 82913577 TGCTGTGGC TGCTGTGGCGGCTGTGGC small insertion Het probably benign 12/04/2019
41 603648 UTSW A030005L19Rik RF018 G1 141.55 N 1 82913572 GTGGCTGCT GTGGCTGCTTTGGCTGCT small insertion Het probably benign 12/04/2019
42 603859 UTSW A030005L19Rik RF021 G1 199.72 N 1 82913569 GTGGTGGCTG GTGGTGGCTGTGGTGGCTG small insertion Het probably benign 12/04/2019
43 604207 UTSW A030005L19Rik RF028 G1 217.48 N 1 82913578 GCTGTG GCTGTGCCTCCTGTG small insertion Het probably benign 12/04/2019
44 604208 UTSW A030005L19Rik RF028 G1 215.92 N 1 82913580 TGTGGCTGC TGTGGCTGCCGTGGCTGC small insertion Het probably benign 12/04/2019
45 604473 UTSW A030005L19Rik RF034 G1 217 N 1 82913580 TGTGGCTGC TGTGGCTGCGGTGGCTGC small insertion Het probably benign 12/04/2019
46 604510 UTSW A030005L19Rik RF035 G1 217.47 N 1 82913589 T TTTGGCTGCC small insertion Het probably benign 12/04/2019
47 604647 UTSW A030005L19Rik RF038 G1 183.48 N 1 82913580 TGT TGTAGCTGCGGT small insertion Het probably benign 12/04/2019
48 604747 UTSW A030005L19Rik RF040 G1 217.52 N 1 82913577 TGCTGTG TGCTGTGACAGCTGTG small insertion Het probably benign 12/04/2019
49 604748 UTSW A030005L19Rik RF040 G1 214.87 N 1 82913590 G GTGGCTGCTC small insertion Het probably benign 12/04/2019
50 604853 UTSW A030005L19Rik RF042 G1 202.59 N 1 82913584 GCTGCTG GCTGCTGTGACTGCTG small insertion Het probably benign 12/04/2019
51 604944 UTSW A030005L19Rik RF044 G1 214.47 N 1 82913589 TG TGTGGCTGCCG small insertion Het probably benign 12/04/2019
52 605175 UTSW A030005L19Rik RF053 G1 132.98 N 1 82913573 TGGCTGCTG TGGCTGCTGGGGCTGCTG small insertion Het probably benign 12/04/2019
53 605344 UTSW A030005L19Rik RF059 G1 214.46 N 1 82913579 CTGTGGCTG CTGTGGCTGGTGTGGCTG small insertion Het probably benign 12/04/2019
54 605367 UTSW A030005L19Rik RF060 G1 214.46 N 1 82913587 GCTG GCTGTGGCTTCTG small insertion Het probably benign 12/04/2019
55 602977 UTSW Acap3 0.166 RF008 G1 217.47 N 4 155905098 TGG TGGACTGCTGCATCCAGG small insertion Het probably benign 12/04/2019
56 603122 UTSW Acap3 0.166 RF010 G1 214.72 N 4 155905096 CCTGGGCTGCTG CCTGGGCTGCTGCATACTGGGCTGCTG small insertion Het probably benign 12/04/2019
57 603323 UTSW Acap3 0.166 RF013 G1 215.92 N 4 155905096 CCTGGGCTGCTG CCTGGGCTGCTGCATACTGGGCTGCTG small insertion Het probably benign 12/04/2019
58 603930 UTSW Acap3 0.166 RF022 G1 214.46 N 4 155905096 CCTGGGCTGCTG CCTGGGCTGCTGCATACTGGGCTGCTG small insertion Het probably benign 12/04/2019
59 604117 UTSW Acap3 0.166 RF025 G1 217.47 N 4 155905102 CTGCTG CTGCTGCATCCTGGGTTGCTG small insertion Het probably benign 12/04/2019
60 604225 UTSW Acap3 0.166 RF028 G1 217.47 N 4 155905091 TGCATCCTGGGCTGC TGCATCCTGGGCTGCAGCATCCTGGGCTGC small insertion Het probably benign 12/04/2019
61 604406 UTSW Acap3 0.166 RF032 G1 214.46 N 4 155905102 CTGCTG CTGCTGCATCCTGGGATGCTG small insertion Het probably benign 12/04/2019
62 604483 UTSW Acap3 0.166 RF034 G1 217.8 N 4 155905092 GCATCCTGGGCTGCT GCATCCTGGGCTGCTACATCCTGGGCTGCT small insertion Het probably benign 12/04/2019
63 604525 UTSW Acap3 0.166 RF035 G1 217.48 N 4 155905091 TGCATCCTGGGCTGC TGCATCCTGGGCTGCCGCATCCTGGGCTGC small insertion Het probably benign 12/04/2019
64 604576 UTSW Acap3 0.166 RF036 G1 217.47 N 4 155905087 G GGGCTGCATCCTGGGC small insertion Het probably benign 12/04/2019
65 604660 UTSW Acap3 0.166 RF038 G1 217.68 N 4 155905092 GCATCCTGGGCTGCT GCATCCTGGGCTGCTTCATCCTGGGCTGCT small insertion Het probably benign 12/04/2019
66 604704 UTSW Acap3 0.166 RF039 G1 214.46 N 4 155905092 GCATCCTGGGCTGCT GCATCCTGGGCTGCTTCATCCTGGGCTGCT small insertion Het probably benign 12/04/2019
67 604813 UTSW Acap3 0.166 RF041 G1 217.47 N 4 155905100 GGCTGC GGCTGCGGCATCCTGTGCTGC small insertion Het probably benign 12/04/2019
68 605480 UTSW Acap3 0.166 RF064 G1 214.87 N 4 155905100 GGCTGCTG GGCTGCTGCATCCTGCGCTGCTG small insertion Het probably benign 12/04/2019
69 510980 UTSW Ahdc1 0.306 FR4304 214.46 N 4 133062759 CT CTCTT small insertion Homo probably benign phenotype 04/05/2018
70 512028 UTSW Ahdc1 0.306 FR4548 214.46 N 4 133062757 TCC TCCCCC small insertion Homo probably benign phenotype 04/05/2018
71 512029 UTSW Ahdc1 0.306 FR4548 214.46 N 4 133062760 T TCCC small insertion Homo probably benign phenotype 04/05/2018
72 511617 UTSW Ahdc1 0.306 FR4737 214.46 N 4 133062759 CT CTCGT small insertion Homo probably benign phenotype 04/05/2018
73 603613 UTSW Ahdc1 0.306 RF017 G1 214.46 N 4 133062751 ACCACC ACCACCACC small insertion Het probably benign phenotype 12/04/2019
74 262108 UTSW Ahdc1 0.306 T0722 G3 217 N 711 4 133062754 ACCTCCT ACCTCCTCCT small insertion Het probably benign phenotype 02/04/2015
75 262152 UTSW Ahdc1 0.306 T0975 G3 108 N 714 4 133062754 ACCTCCT ACCTCCTCCT small insertion Het probably benign phenotype 02/04/2015
76 512139 UTSW AI837181 0.000 FR4548 131.47 N 19 5425231 CGG CGGGGG small insertion Het probably benign 04/05/2018
77 512140 UTSW AI837181 0.000 FR4548 132.49 N 19 5425237 CG CGGGG small insertion Het probably benign 04/05/2018
78 511980 UTSW AI837181 0.000 FR4976 111.47 N 19 5425229 GGC GGCCGC small insertion Het probably benign 04/05/2018
79 602593 UTSW AI837181 0.000 RF002 G1 154.47 N 19 5425234 CGG CGGTGG small insertion Het probably benign 12/04/2019
80 602594 UTSW AI837181 0.000 RF002 G1 156.47 N 19 5425235 GGC GGCTGC small insertion Het probably benign 12/04/2019
81 603020 UTSW AI837181 0.000 RF008 G1 133.47 N 19 5425238 G GGCT small insertion Het probably benign 12/04/2019
82 603101 UTSW AI837181 0.000 RF009 G1 124.47 N 19 5425234 CGG CGGTGG small insertion Het probably benign 12/04/2019
83 603236 UTSW AI837181 0.000 RF011 G1 127.47 N 19 5425236 GCG GCGTCG small insertion Het probably benign 12/04/2019
84 603302 UTSW AI837181 0.000 RF012 G1 121.47 N 19 5425227 GCG GCGTCG small insertion Het probably benign 12/04/2019
85 603379 UTSW AI837181 0.000 RF013 G1 122.47 N 19 5425232 GGC GGCTGC small insertion Het probably benign 12/04/2019
86 603910 UTSW AI837181 0.000 RF021 G1 128.47 N 19 5425234 CGG CGGTGG small insertion Het probably benign 12/04/2019
87 604144 UTSW AI837181 0.000 RF025 G1 101.47 N 19 5425226 GGC GGCCGC small insertion Het probably benign 12/04/2019
88 604174 UTSW AI837181 0.000 RF026 G1 122.47 N 19 5425224 GCG GCGTCG small insertion Het probably benign 12/04/2019
89 604341 UTSW AI837181 0.000 RF030 G1 162.47 N 19 5425226 GGC GGCTGC small insertion Het probably benign 12/04/2019
90 604342 UTSW AI837181 0.000 RF030 G1 161.47 N 19 5425235 GGC GGCCGC small insertion Het probably benign 12/04/2019
91 604385 UTSW AI837181 0.000 RF031 G1 135.47 N 19 5425218 GCG GCGCCG small insertion Het probably benign 12/04/2019
92 604465 UTSW AI837181 0.000 RF033 G1 113.47 N 19 5425224 GCG GCGTCG small insertion Het probably benign 12/04/2019
93 604466 UTSW AI837181 0.000 RF033 G1 134.47 N 19 5425237 CG CGGTG small insertion Het probably benign 12/04/2019
94 604555 UTSW AI837181 0.000 RF035 G1 111.47 N 19 5425238 G GGCT small insertion Het probably benign 12/04/2019
95 604690 UTSW AI837181 0.000 RF038 G1 128.47 N 19 5425226 GGC GGCAGC small insertion Het probably benign 12/04/2019
96 604691 UTSW AI837181 0.000 RF038 G1 118.47 N 19 5425236 GCG GCGACG small insertion Het probably benign 12/04/2019
97 604846 UTSW AI837181 0.000 RF041 G1 123.47 N 19 5425229 GGC GGCTGC small insertion Het probably benign 12/04/2019
98 604889 UTSW AI837181 0.000 RF042 G1 126.47 N 19 5425217 GGC GGCTGC small insertion Het probably benign 12/04/2019
99 604890 UTSW AI837181 0.000 RF042 G1 151.47 N 19 5425237 CG CGGTG small insertion Het probably benign 12/04/2019
100 605010 UTSW AI837181 0.000 RF045 G1 114.47 N 19 5425218 GCG GCGCCG small insertion Het probably benign 12/04/2019
[records 1 to 100 of 1681] next >> last >|