Incidental Mutations

735 incidental mutations are currently displayed, and affect 162 genes.
0 are Possibly Damaging.
0 are Probably Damaging.
735 are Probably Benign.
0 are Probably Null.
0 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 735] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 207681 UTSW 1110038F14Rik R1845 G1 131 N 15 76949663 CGGG CGGGGGG small insertion Het probably benign 06/23/2014
2 313366 UTSW 1110038F14Rik R4023 G1 153 N 15 76949663 CGGG CGGGGGG small insertion Het probably benign 04/30/2015
3 510963 UTSW 4930402H24Rik 0.000 FR4304 198.47 N 2 130770748 TCC TCCCCC small insertion Het probably benign phenotype 04/05/2018
4 511206 UTSW 4930402H24Rik 0.000 FR4342 156.47 N 2 130770742 TCC TCCCCC small insertion Het probably benign phenotype 04/05/2018
5 511320 UTSW 4930402H24Rik 0.000 FR4589 142.47 N 2 130770752 CC CCTGC small insertion Het probably benign phenotype 04/05/2018
6 511319 UTSW 4930402H24Rik 0.000 FR4589 203.47 N 2 130770745 TCC TCCCCC small insertion Het probably benign phenotype 04/05/2018
7 511589 UTSW 4930402H24Rik 0.000 FR4737 145.47 N 2 130770752 CC CCTGC small insertion Het probably benign phenotype 04/05/2018
8 511808 UTSW 4930402H24Rik 0.000 FR4976 147.47 N 2 130770742 TCC TCCACC small insertion Het probably benign phenotype 04/05/2018
9 511807 UTSW 4930402H24Rik 0.000 FR4976 150.47 N 2 130770739 TCC TCCCCC small insertion Het probably benign phenotype 04/05/2018
10 511809 UTSW 4930402H24Rik 0.000 FR4976 135.47 N 2 130770753 C CTCG small insertion Het probably benign phenotype 04/05/2018
11 512078 UTSW 4932415D10Rik 0.084 FR4548 214.46 N 10 82290996 G GTCATTA small insertion Homo probably benign 04/05/2018
12 156747 UTSW 4933415A04Rik R1332 G1 155 N 11 43587429 T TNNNNNNNNNNNNNNNNNN small insertion Het probably benign 02/11/2014
13 510980 UTSW Ahdc1 0.274 FR4304 214.46 N 4 133062759 CT CTCTT small insertion Homo probably benign phenotype 04/05/2018
14 512029 UTSW Ahdc1 0.274 FR4548 214.46 N 4 133062760 T TCCC small insertion Homo probably benign phenotype 04/05/2018
15 512028 UTSW Ahdc1 0.274 FR4548 214.46 N 4 133062757 TCC TCCCCC small insertion Homo probably benign phenotype 04/05/2018
16 511617 UTSW Ahdc1 0.274 FR4737 214.46 N 4 133062759 CT CTCGT small insertion Homo probably benign phenotype 04/05/2018
17 262108 UTSW Ahdc1 0.274 T0722 G3 217 N 711 4 133062754 ACCTCCT ACCTCCTCCT small insertion Het probably benign phenotype 02/04/2015
18 262152 UTSW Ahdc1 0.274 T0975 G3 108 N 714 4 133062754 ACCTCCT ACCTCCTCCT small insertion Het probably benign phenotype 02/04/2015
19 512139 UTSW AI837181 0.000 FR4548 131.47 N 19 5425231 CGG CGGGGG small insertion Het probably benign 04/05/2018
20 512140 UTSW AI837181 0.000 FR4548 132.49 N 19 5425237 CG CGGGG small insertion Het probably benign 04/05/2018
21 511980 UTSW AI837181 0.000 FR4976 111.47 N 19 5425229 GGC GGCCGC small insertion Het probably benign 04/05/2018
22 511897 UTSW Akap12 0.142 FR4976 218.26 N 10 4353837 AAA AAACAA small insertion Het probably benign phenotype 04/05/2018
23 511011 UTSW Alpk3 0.449 FR4304 217.47 N 7 81077762 TCT TCTGCT small insertion Het probably benign phenotype 04/05/2018
24 511661 UTSW Alpk3 0.449 FR4737 210.48 N 7 81077762 TCT TCTACT small insertion Het probably benign phenotype 04/05/2018
25 479784 UTSW Amer1 R6011 G1 133.97 N X 95427283 ATTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTC ATTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTC small insertion Het probably benign phenotype 06/26/2017
26 511074 UTSW Ankhd1 0.000 FR4304 217.47 N 18 36560924 GGCGGC GGCGGCTGCGGC small insertion Het probably benign 04/05/2018
27 511259 UTSW Anxa2 0.000 FR4342 154.47 N 9 69480210 C CCCA small insertion Het probably benign phenotype 04/05/2018
28 511258 UTSW Anxa2 0.000 FR4342 130.47 N 9 69480205 CCC CCCACC small insertion Het probably benign phenotype 04/05/2018
29 512069 UTSW Anxa2 0.000 FR4548 104.47 N 9 69480203 CCC CCCTCC small insertion Het probably benign phenotype 04/05/2018
30 511365 UTSW Anxa2 0.000 FR4589 149.47 N 9 69480210 C CCCA small insertion Het probably benign phenotype 04/05/2018
31 510951 UTSW Arhgap30 0.000 FR4304 217.47 N 1 171405168 TGGCCC TGGCCCTGGCCCAGGCCTTGGCCCCGGCCC small insertion Het probably benign 04/05/2018
32 511538 UTSW Arid1b 0.728 FR4449 102.47 N 17 4995589 CGG CGGTGG small insertion Het probably benign phenotype 04/05/2018
33 582591 UTSW Arid1b 0.728 R7519 G1 217.47 N 17 4995844 GGGCGGCGGCGGCGGCGGCGGCGG GGGCGGCGGCGGCGGCGGCGGCGGCGGCGG small insertion Het probably benign phenotype 10/17/2019
34 582592 UTSW Arid1b 0.728 R7519 G1 217.47 N 17 4995853 CGGCGG CGGCGGTGGCGG small insertion Het probably benign phenotype 10/17/2019
35 582681 UTSW Arid1b 0.728 R7521 G1 217.47 N 17 4995844 GGGCGGCGGCGGCGGCGGCGGCGG GGGCGGCGGCGGCGGCGGCGGCGGCGGCGG small insertion Het probably benign phenotype 10/17/2019
36 582682 UTSW Arid1b 0.728 R7521 G1 217.47 N 17 4995860 GGCGGC GGCGGCAGCGGC small insertion Het probably benign phenotype 10/17/2019
37 258600 UTSW Asap3 0.106 R3703 G1 217 Y 4 136241241 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGAGGAGGA small insertion Het probably benign 0.116 phenotype 01/23/2015
38 258643 UTSW Asap3 0.106 R3704 G1 217 Y 4 136241241 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGAGGAGGA small insertion Het probably benign 0.116 phenotype 01/23/2015
39 258694 UTSW Asap3 0.106 R3705 G1 217 Y 4 136241241 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGAGGAGGA small insertion Het probably benign 0.116 phenotype 01/23/2015
40 482824 UTSW Atp2b4 0.320 R6078 G1 188.47 N 1 133701702 TTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTT TTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTT small insertion Het probably benign phenotype 07/14/2017
41 482846 UTSW Atp2b4 0.320 R6079 G1 122.47 N 1 133701702 TTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTT TTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTT small insertion Het probably benign phenotype 07/14/2017
42 96244 UTSW AU022751 0.075 R1015 G1 217 N X 6082591 GTCATCATCATCATC GTCATCATCATCATCATC small insertion Het probably benign 0.102 01/05/2014
43 98227 UTSW AU022751 0.075 R1102 G1 214 Y X 6082591 GTCATCATCATCATC GTCATCATCATCATCATC small insertion Het probably benign 0.102 01/05/2014
44 168588 UTSW AU022751 0.075 R1513 G1 214 N X 6082591 GTCATCATCATCATC GTCATCATCATCATCATC small insertion Het probably benign 0.102 04/13/2014
45 209501 UTSW AU022751 0.075 R1885 G1 214 N X 6082591 GTCATCATCATCATC GTCATCATCATCATCATC small insertion Het probably benign 0.102 06/30/2014
46 209606 UTSW AU022751 0.075 R1886 G1 214 N X 6082591 GTCATCATCATCATC GTCATCATCATCATCATC small insertion Het probably benign 0.102 06/30/2014
47 209700 UTSW AU022751 0.075 R1887 G1 152 N X 6082591 GTCATCATCATCATC GTCATCATCATCATCATC small insertion Het probably benign 0.102 06/30/2014
48 225804 UTSW AU022751 0.075 R1996 G1 214 Y X 6082591 GTCATCATCATCATC GTCATCATCATCATCATC small insertion Het probably benign 0.102 08/25/2014
49 511528 UTSW B430218F22Rik 0.141 FR4449 215.1 N 13 118386851 CGGCG CGGCGATGGCG small insertion Homo probably benign 04/05/2018
50 543745 UTSW BC028528 0.085 R6980 G1 214.46 N 3 95888136 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT small insertion Het probably benign 05/13/2019
51 543746 UTSW BC028528 0.085 R6980 G1 217.47 N 3 95888139 ACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTC ACTGGTTCTGTGGTCTCTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTC small insertion Het probably benign 05/13/2019
52 543747 UTSW BC028528 0.085 R6980 G1 217.47 N 3 95888168 CACTGGTTCTGTGGT CACTGGTTCTGTGGTTACTGGTTCTGTGGT small insertion Het probably benign 05/13/2019
53 558884 UTSW BC028528 0.085 R7180 G1 214.46 N 3 95888136 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT small insertion Het probably benign 06/26/2019
54 567377 UTSW BC028528 0.085 R7308 G1 214.46 N 3 95888136 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT small insertion Het probably benign 06/26/2019
55 567378 UTSW BC028528 0.085 R7308 G1 217.47 N 3 95888152 TCACTGGTTCTGTGGTCACTGGTTCTGTGG TCACTGGTTCTGTGGCCACTGGTTCTGTGGTCACTGGTTCTGTGG small insertion Het probably benign 06/26/2019
56 567379 UTSW BC028528 0.085 R7308 G1 217.47 N 3 95888169 ACTGGTTCTGTGGTC ACTGGTTCTGTGGTCCCTGGTTCTGTGGTC small insertion Het probably benign 06/26/2019
57 567478 UTSW BC028528 0.085 R7310 G1 214.46 N 3 95888136 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT small insertion Het probably benign 06/26/2019
58 567479 UTSW BC028528 0.085 R7310 G1 217.47 N 3 95888139 ACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTC ACTGGTTCTGTGGTCCCTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTC small insertion Het probably benign 06/26/2019
59 567480 UTSW BC028528 0.085 R7310 G1 217.47 N 3 95888148 G GGGGTCACTGGTTCTT small insertion Het probably benign 06/26/2019
60 567481 UTSW BC028528 0.085 R7310 G1 217.47 N 3 95888173 GTTCTGTGGTCACTG GTTCTGTGGTCACTGATTCTGTGGTCACTG small insertion Het probably benign 06/26/2019
61 570936 UTSW BC028528 0.085 R7356 G1 214.46 N 3 95888136 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT small insertion Het probably benign 09/13/2019
62 570937 UTSW BC028528 0.085 R7356 G1 217.47 N 3 95888141 TGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCAC TGGTTCTGTGGTCACGGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCAC small insertion Het probably benign 09/13/2019
63 570938 UTSW BC028528 0.085 R7356 G1 217.47 N 3 95888158 GTTCTGTGGTCACTGGTTCTGTGGTCACTG GTTCTGTGGTCACTGCTTCTGTGGTCACTGGTTCTGTGGTCACTG small insertion Het probably benign 09/13/2019
64 570939 UTSW BC028528 0.085 R7356 G1 217.47 N 3 95888165 GGTCACTGGTTCTGT GGTCACTGGTTCTGTAGTCACTGGTTCTGT small insertion Het probably benign 09/13/2019
65 570940 UTSW BC028528 0.085 R7356 G1 217.47 N 3 95888175 TCTGTGGTCACTGGT TCTGTGGTCACTGGTCCTGTGGTCACTGGT small insertion Het probably benign 09/13/2019
66 570941 UTSW BC028528 0.085 R7356 G1 217.47 N 3 95888183 CACTGGTT CACTGGTTCTATGGTGACTGGTT small insertion Het probably benign 09/13/2019
67 572370 UTSW BC028528 0.085 R7376 G1 217.47 N 3 95888136 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT small insertion Het probably benign 09/13/2019
68 572371 UTSW BC028528 0.085 R7376 G1 217.47 N 3 95888154 ACTGGTTCTGTGGTCACTGGTTCTGTGGTC ACTGGTTCTGTGGTCCCTGGTTCTGTGGTCACTGGTTCTGTGGTC small insertion Het probably benign 09/13/2019
69 572372 UTSW BC028528 0.085 R7376 G1 217.47 N 3 95888155 CTGGTTCTG CTGGTTCTGCGGTCATTGGTTCTG small insertion Het probably benign 09/13/2019
70 572373 UTSW BC028528 0.085 R7376 G1 217.47 N 3 95888165 GGTCACTGGTTCTGT GGTCACTGGTTCTGTTGTCACTGGTTCTGT small insertion Het probably benign 09/13/2019
71 576373 UTSW BC028528 0.085 R7430 G1 214.46 N 3 95888136 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT small insertion Het probably benign 10/07/2019
72 576374 UTSW BC028528 0.085 R7430 G1 217.47 N 3 95888169 ACTGGTTCTGTGGTC ACTGGTTCTGTGGTCTCTGGTTCTGTGGTC small insertion Het probably benign 10/07/2019
73 580659 UTSW BC028528 0.085 R7490 G1 214.46 N 3 95888136 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT small insertion Het probably benign 10/17/2019
74 580660 UTSW BC028528 0.085 R7490 G1 217.47 N 3 95888166 GTCACTGGTTCTGTG GTCACTGGTTCTGTGTTCACTGGTTCTGTG small insertion Het probably benign 10/17/2019
75 580661 UTSW BC028528 0.085 R7490 G1 217.47 N 3 95888186 TGGTT TGGTTCTGTGGTCACGGGTT small insertion Het probably benign 10/17/2019
76 580730 UTSW BC028528 0.085 R7491 G1 214.46 N 3 95888136 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT small insertion Het probably benign 10/17/2019
77 580731 UTSW BC028528 0.085 R7491 G1 217.47 N 3 95888138 CACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGT CACTGGTTCTGTGGTTACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGT small insertion Het probably benign 10/17/2019
78 581062 UTSW BC028528 0.085 R7496 G1 217.47 N 3 95888177 TGTGGTCACTGGTT TGTGGTCACTGGTTCAGTGGTCACTGGTT small insertion Het probably benign 10/17/2019
79 581118 UTSW BC028528 0.085 R7497 G1 214.46 N 3 95888136 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT small insertion Het probably benign 10/17/2019
80 581119 UTSW BC028528 0.085 R7497 G1 217.47 N 3 95888171 TGGTTCTGTGGTCAC TGGTTCTGTGGTCACAGGTTCTGTGGTCAC small insertion Het probably benign 10/17/2019
81 581189 UTSW BC028528 0.085 R7498 G1 214.46 N 3 95888136 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT small insertion Het probably benign 10/17/2019
82 581190 UTSW BC028528 0.085 R7498 G1 217.47 N 3 95888182 TCACTGGTT TCACTGGTTCTGTGGACACTGGTT small insertion Het probably benign 10/17/2019
83 584454 UTSW BC028528 0.085 R7552 G1 217.47 N 3 95888169 ACTGGTTCTGTGGTC ACTGGTTCTGTGGTCGCTGGTTCTGTGGTC small insertion Het probably benign 10/17/2019
84 585358 UTSW BC028528 0.085 R7565 G1 214.46 N 3 95888136 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT small insertion Het probably benign 10/17/2019
85 585359 UTSW BC028528 0.085 R7565 G1 217.47 N 3 95888138 CACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGT CACTGGTTCTGTGGTGACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGT small insertion Het probably benign 10/17/2019
86 585360 UTSW BC028528 0.085 R7565 G1 217.47 N 3 95888144 TTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGG TTCTGTGGTCACTGGGTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGG small insertion Het probably benign 10/17/2019
87 585435 UTSW BC028528 0.085 R7566 G1 214.46 N 3 95888136 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT small insertion Het probably benign 10/17/2019
88 585436 UTSW BC028528 0.085 R7566 G1 217.47 N 3 95888145 TCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGT TCTGTGGTCACTGGTACTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGT small insertion Het probably benign 10/17/2019
89 585573 UTSW BC028528 0.085 R7568 G1 214.46 N 3 95888136 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT small insertion Het probably benign 10/17/2019
90 585574 UTSW BC028528 0.085 R7568 G1 217.47 N 3 95888151 GTCACTGGTTCTGTGGTCACTGGTTCTGTG GTCACTGGTTCTGTGATCACTGGTTCTGTGGTCACTGGTTCTGTG small insertion Het probably benign 10/17/2019
91 585575 UTSW BC028528 0.085 R7568 G1 217.47 N 3 95888172 GGTTCTGTGGTCACT GGTTCTGTGGTCACTAGTTCTGTGGTCACT small insertion Het probably benign 10/17/2019
92 585624 UTSW BC028528 0.085 R7569 G1 214.46 N 3 95888136 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT small insertion Het probably benign 10/17/2019
93 527100 UTSW Bcl9l 0.000 R6670 G1 217.47 Y 9 44507072 GTGAACATGAACATGAACATGAAC GTGAACATGAACATGAACATGAACATGAAC small insertion Het probably benign phenotype 07/23/2018
94 237150 UTSW Bdp1 1.000 R2180 G1 194 N 13 100061405 ATTCTTCTTCTTCTTCTTC ATTCTTCTTCTTCTTCTTCTTC small insertion Het probably benign phenotype 10/02/2014
95 511010 UTSW Blm 1.000 FR4304 181.47 N 7 80512919 TCCTCCTCCTCC TCCTCCTCCTCCACCTCCTCCTCC small insertion Het probably benign phenotype 04/05/2018
96 511132 UTSW Blm 1.000 FR4340 178.47 N 7 80512907 TCCTCCTCCTCCTCCTCCTCCTCC TCCTCCTCCTCCGCCTCCTCCTCCTCCTCCTCCTCC small insertion Het probably benign phenotype 04/05/2018
97 511133 UTSW Blm 1.000 FR4340 195.47 N 7 80512910 TCCTCCTCCTCCTCCTCCTCCTCC TCCTCCTCCTCCACCTCCTCCTCCTCCTCCTCCTCC small insertion Het probably benign phenotype 04/05/2018
98 511483 UTSW Blm 1.000 FR4449 176.47 N 7 80512908 CCTCCTCCTCCTCCTCCTCCTCCT CCTCCTCCTCCTTCTCCTCCTCCTCCTCCTCCTCCT small insertion Het probably benign phenotype 04/05/2018
99 511869 UTSW Blm 1.000 FR4976 217.47 N 7 80512907 TCCTCCTCCTCCTCCTCCTCCTCC TCCTCCTCCTCCACCTCCTCCTCCTCCTCCTCCTCC small insertion Het probably benign phenotype 04/05/2018
100 511021 UTSW Btnl10 0.061 FR4304 214.46 N 11 58923930 GA GAATA small insertion Homo probably benign 04/05/2018
[records 1 to 100 of 735] next >> last >|