Incidental Mutations

864 incidental mutations are currently displayed, and affect 426 genes.
0 are Possibly Damaging.
0 are Probably Damaging.
850 are Probably Benign.
3 are Probably Null.
0 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 864] next >> last >| per page Full List
ID question?
Source question?
Gene question?
E-score question?
Stock # question?
Gen question?
Vld question?
Strain question?
Chr question?
Position question?
Mutation question?
Type question?
Exon Dist question?
Zygosity question?
Predicted Effect question?
PPH Score question?
Meta Score question?
MGI Phenotype question?
Posted question?
1 66158 UTSW 1110002E22Rik 0.263 R0239 G1 153 N 3 138065834 TTCCTCCTCCTCCTCCTCCTCC TTCCTCCTCCTCCTCCTCC small deletion Het probably benign 08/19/2013
3 66840 UTSW 1700016K19Rik 0.054 R0025 G1 109 N 11 76000115 AGAGGAGGAGGAGGAGG AGAGGAGGAGGAGG small deletion Het probably benign 08/19/2013
4 535605 UTSW 1700021F05Rik 0.378 R6850 G1 217.47 N 10 43532725 ACTGCACCACCT ACT small deletion Het probably benign 09/12/2018
5 535932 UTSW 1700021F05Rik 0.378 R6866 G1 217.47 N 10 43532725 ACTGCACCACCT ACT small deletion Het probably benign 10/18/2018
6 535983 UTSW 1700021F05Rik 0.378 R6867 G1 217.47 N 10 43532725 ACTGCACCACCT ACT small deletion Het probably benign 10/18/2018
7 270815 UTSW 4930402K13Rik 0.021 R3726 G1 214 Y X 9105103 AGAGGAG AGAG small deletion Het probably benign 03/18/2015
8 511007 UTSW 4930433I11Rik 0.092 FR4304 217.47 N 7 40993056 ACCTC AC small deletion Het probably benign 04/05/2018
9 511129 UTSW 4930433I11Rik 0.092 FR4340 217.47 N 7 40993055 AACC A small deletion Het probably benign 04/05/2018
10 511245 UTSW 4930433I11Rik 0.092 FR4342 186.47 N 7 40993055 AACC A small deletion Het probably benign 04/05/2018
11 512052 UTSW 4930433I11Rik 0.092 FR4548 217.47 N 7 40993056 ACCTC AC small deletion Het probably benign 04/05/2018
12 511032 UTSW 4930447C04Rik 0.326 FR4304 105.46 N 12 72881287 AAGT A small deletion Homo probably benign phenotype 04/05/2018
13 510989 UTSW 4930548H24Rik 0.077 FR4304 214.46 N 5 31487373 GAGAAG GAG small deletion Homo probably benign 04/05/2018
14 511114 UTSW 4930548H24Rik 0.077 FR4340 217.47 N 5 31487373 GAGAAG GAG small deletion Het probably benign 04/05/2018
15 511231 UTSW 4930548H24Rik 0.077 FR4342 214.46 N 5 31487373 GAGAAG GAG small deletion Homo probably benign 04/05/2018
16 511339 UTSW 4930548H24Rik 0.077 FR4589 217.47 N 5 31487373 GAGAAG GAG small deletion Het probably benign 04/05/2018
17 478031 UTSW 4930548H24Rik 0.077 LCD18 G1 999 Y 5 31487373 GAGAAG GAG small deletion Het probably benign 05/17/2017
18 511690 UTSW 4932415D10Rik 0.188 FR4737 134.46 N 10 82285469 TTCA T small deletion Homo probably benign 04/05/2018
19 152388 UTSW 6030419C18Rik 0.115 R1234 G1 101 N 9 58499432 AGAGGAGGAGGAGGAGG AGAGGAGGAGGAGG small deletion Het probably benign 01/29/2014
20 163221 UTSW 6030419C18Rik 0.115 R1385 G1 105 N 9 58499432 AGAGGAGGAGGAGGAGG AGAGGAGGAGGAGG small deletion Het probably benign 03/17/2014
21 307546 UTSW 6030419C18Rik 0.115 R3943 G1 124 Y 9 58499432 AGAGGAGGAGGAGGAGG AGAGGAGGAGGAGG small deletion Het probably benign 04/17/2015
22 344954 UTSW 6030419C18Rik 0.115 R4614 G1 105 Y 9 58499432 AGAGGAGGAGGAGGAGG AGAGGAGGAGGAGG small deletion Het probably benign 09/25/2015
23 151886 UTSW 9530077C05Rik 0.178 R1239 G1 217 Y 9 22424699 GTTCTTC GTTC small deletion Het probably benign 0.056 01/29/2014
24 62139 UTSW A230050P20Rik 0.233 R0669 G1 104 N 9 20873717 AGAGGAGGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGAGGAGGA small deletion Het probably benign 07/30/2013
25 169187 UTSW A230050P20Rik 0.233 R1500 G1 106 N 9 20873717 AGAGGAGGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGAGGAGGA small deletion Het probably benign 04/13/2014
26 265129 UTSW A230050P20Rik 0.233 R3055 G1 108 N 9 20873717 AGAGGAGGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGAGGAGGA small deletion Het probably benign 02/05/2015
27 519124 UTSW A430033K04Rik 0.155 R6444 G1 217.47 Y 5 138639569 ACAGAGCAGTGCCTACCAG ACAG small deletion Het probably benign 05/24/2018
28 511191 UTSW A530064D06Rik 0.000 FR4340 214.46 N 17 48163381 GTAGGAAGCTTAG GTAG small deletion Homo probably benign 04/05/2018
29 511426 UTSW A530064D06Rik 0.000 FR4589 214.46 N 17 48163381 GTAGGAAGCTTAG GTAG small deletion Homo probably benign 04/05/2018
30 511571 UTSW A630001G21Rik 0.075 FR4737 130.46 N 1 85723135 CTGTT CT small deletion Homo probably benign 04/05/2018
31 272528 UTSW A630073D07Rik 0.139 R3791 G1 111 N 6 132626516 AGGTGGTGGTGGTGGTGGTGGTGG AGGTGGTGGTGGTGGTGGTGG small deletion Het probably benign 03/25/2015
32 197497 UTSW Aak1 0.288 Y4335 102 N 6 86959142 ACAGCAGCAGCAGCAGCAGCAGCAGC ACAGCAGCAGCAGCAGCAGCAGC small deletion Het probably benign phenotype 05/23/2014
33 152561 UTSW Abcb10 1.000 V7581 152 N stinger 8 123969761 GGCCATCG GG small deletion Het probably benign phenotype 01/29/2014
34 511627 UTSW Abcb4 0.000 FR4737 172.46 N 5 8896597 GAAA G small deletion Homo probably benign phenotype 04/05/2018
35 512101 UTSW Abt1 0.966 FR4548 167.47 N 13 23423711 TTCTTGCT TT small deletion Het probably benign phenotype 04/05/2018
36 511928 UTSW Abt1 0.966 FR4976 115.47 N 13 23423711 TTCTTGCT TT small deletion Het probably benign phenotype 04/05/2018
37 66949 UTSW Acbd3 0.367 R0524 G1 106 N 1 180747059 CGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGA small deletion Het probably benign phenotype 08/19/2013
38 80999 UTSW Acbd3 0.367 R0884 G1 185 N 1 180747059 CGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGA small deletion Het probably benign phenotype 11/07/2013
39 81607 UTSW Adgrb2 0.000 R0965 G1 112 N 4 129992416 AGAGGAGGAGGAGGAGGAGG AGAGGAGGAGGAGGAGG small deletion Het probably benign phenotype 11/08/2013
40 519907 UTSW Adgrb2 0.000 R6511 G1 119.47 N 4 129992416 AGAGGAGGAGGAGGAGGAGG AGAGGAGGAGGAGGAGG small deletion Het probably benign phenotype 06/06/2018
41 240955 UTSW AI593442 0.207 R2248 G1 138 N 9 52677814 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGA small deletion Het probably benign 10/15/2014
42 387126 UTSW AI593442 0.207 R5081 G1 133 N 9 52677814 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGA small deletion Het probably benign 06/06/2016
43 515615 UTSW Ak6 0.948 R6386 G1 217.47 N 13 100655803 TGACGA TGA small deletion Het probably benign phenotype 05/04/2018
44 95062 UTSW Ak7 0.244 R1028 G1 127 N 12 105710189 AGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGA small deletion Het probably benign phenotype 01/05/2014
45 208442 UTSW Akp3 0.286 R1864 G1 102 N 1 87127767 TCACCACCACCACCACCACCACCACCACCAC TCACCACCACCACCACCACCACCACCAC small deletion Het probably benign phenotype 06/30/2014
46 434793 UTSW Amer2 0.205 R5535 G1 103 N 14 60378853 AAGGAGGAGGAGGAG AAGGAGGAGGAG small deletion Het probably benign 10/24/2016
47 511792 UTSW Anapc2 1.000 FR4976 217.47 N 2 25272532 TGGCGGTGGCGGCGGCGGCGGCGGCGGCGG TGGCGGCGGCGGCGGCGG small deletion Het probably benign phenotype 04/05/2018
48 524457 UTSW Anapc2 1.000 R6587 G1 166.47 N 2 25272538 TGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCG TGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCG small deletion Het probably benign phenotype 06/22/2018
49 95048 UTSW Ano8 0.285 R1028 G1 104 N 8 71480971 GCCTCCTCCTCCTCCTC GCCTCCTCCTCCTC small deletion Het probably benign 01/05/2014
50 501296 UTSW Ap1s1 0.217 R5690 G1 115 N 5 137037379 ATCCTCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTC small deletion Het probably benign phenotype 12/01/2017
51 262370 UTSW Arhgap28 0.198 R0811 G1 120 N 17 67901299 TCAGCAGCAGCAGCAGCAGCAG TCAGCAGCAGCAGCAGCAG small deletion Het probably benign phenotype 02/04/2015
52 539874 UTSW Arhgap28 0.198 R6928 G1 108.47 N 17 67901299 TCAGCAGCAGCAGCAGCAGCAG TCAGCAGCAGCAGCAGCAG small deletion Het probably benign phenotype 11/06/2018
53 500780 UTSW Arhgef10l 0.282 R3732 G1 108 N 4 140581619 AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA small deletion Het probably benign phenotype 12/01/2017
54 451402 UTSW Arhgef10l 0.282 R5720 G1 135 N 4 140581619 AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA small deletion Het probably benign phenotype 01/03/2017
55 162533 UTSW Arhgef17 0.780 R1389 G1 110 N 7 100931037 TGGAGGAGGAGGAGGAGG TGGAGGAGGAGGAGG small deletion Het probably benign 03/17/2014
56 389375 UTSW Arih2 1.000 R5033 G1 217 N 9 108611660 AGCCG AG small deletion Het probably benign phenotype 06/06/2016
57 368164 UTSW Atoh7 0.538 R4779 G1 217 Y 10 63100408 ATGGCGCT AT small deletion Het probably benign phenotype 12/29/2015
58 329046 UTSW Atp10a 0.539 R4453 G1 167 N 7 58658500 TGGCGGCGGC TGGCGGC small deletion Het probably benign p23DFiOD deletion may be responsible for the obesity phenotypes associated with that deletion. [provided by MGI curators] (source: MGI)">phenotype 07/21/2015
59 352851 UTSW Atp10a 0.539 R4661 G1 217 N 7 58658500 TGGCGGCGGC TGGCGGC small deletion Het probably benign p23DFiOD deletion may be responsible for the obesity phenotypes associated with that deletion. [provided by MGI curators] (source: MGI)">phenotype 10/08/2015
60 167236 UTSW Atp2b3 0.101 R1518 G1 214 N X 73545123 GACAACA GACA small deletion Het probably benign phenotype 04/13/2014
61 94723 UTSW Atxn2l 0.771 R1132 G1 110 N 7 126494248 CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC small deletion Het probably benign phenotype 01/05/2014
62 517567 UTSW Atxn2l 0.771 R6460 G1 136.47 N 7 126494248 CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC small deletion Het probably benign phenotype 05/21/2018
63 523869 UTSW Atxn2l 0.771 R6578 G1 100.47 N 7 126494248 CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC small deletion Het probably benign phenotype 06/22/2018
64 537253 UTSW AU015836 0.366 R6891 G1 116.47 N X 93969111 TGAGGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGAGGA small deletion Het probably benign 10/18/2018
65 486101 UTSW Baz2a 0.501 R6088 G1 217.47 Y 10 128114642 TCTCCTC TCTC small deletion Het probably benign 08/16/2017
66 484669 UTSW Baz2a 0.501 R6089 G1 217.47 N 10 128114642 TCTCCTC TCTC small deletion Het probably benign 08/16/2017
67 476697 UTSW BC024139 0.066 R2697 G1 152 N 15 76120193 TCCACCACCACCACCACCAC TCCACCACCACCACCAC small deletion Het probably benign 05/15/2017
68 276068 UTSW Bend3 0.487 R3854 G1 146 Y 10 43510717 AAGGACCA AA small deletion Het probably benign 04/06/2015
69 315084 UTSW Blm 1.000 R4155 G1 127 N 7 80512904 GCCTCCTCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCCTCCTCC small deletion Het probably benign phenotype 05/14/2015
70 489970 UTSW Blm 1.000 R6163 G1 102.47 N 7 80512904 GCCTCCTCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCCTCCTCC small deletion Het probably benign phenotype 10/10/2017
71 519192 UTSW Blm 1.000 R6446 G1 111.47 N 7 80512904 GCCTCCTCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCCTCCTCC small deletion Het probably benign phenotype 05/24/2018
72 511891 UTSW Bmp5 0.468 FR4976 216.23 N 9 75776375 GAGGAGT G small deletion Homo probably benign phenotype 04/05/2018
73 262446 UTSW Bmp6 0.000 R1218 G1 116 N 13 38346250 ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAGCAGCAGCAGCAG small deletion Het probably benign phenotype 02/04/2015
74 101591 UTSW Brd2 1.000 R1150 G1 217 N 17 34114007 ATCTTCTTC ATCTTC small deletion Het probably benign 0.081 phenotype 01/15/2014
75 101625 UTSW Brd2 1.000 R1152 G1 217 N 17 34114007 ATCTTCTTC ATCTTC small deletion Het probably benign 0.081 phenotype 01/15/2014
76 162265 UTSW Brd2 1.000 R1426 G1 217 Y 17 34114007 ATCTTCTTC ATCTTC small deletion Het probably benign 0.081 phenotype 03/14/2014
77 202034 UTSW Brdt 0.000 R1794 G1 111 N 5 107359853 ACAGCAGCAGCAGCAGC ACAGCAGCAGCAGC small deletion Het probably benign phenotype 06/23/2014
78 402509 UTSW Btbd11 0.276 R5224 G1 217 Y 10 85645522 CGTGACCTTTCTGGT CGT small deletion Het probably benign 0.064 07/22/2016
79 528611 UTSW C2cd6 0.024 R6697 G1 217.47 N 1 59051088 ATGTGGCCTGTCTTCT A small deletion Het probably benign 07/24/2018
80 322039 UTSW Carmil3 0.268 R4285 G1 217 Y 14 55499476 GGACGA GGA small deletion Het probably benign 0.064 06/20/2015
81 332032 UTSW Carmil3 0.268 R4506 G1 217 Y 14 55499476 GGACGA GGA small deletion Het probably benign 0.064 07/21/2015
82 332069 UTSW Carmil3 0.268 R4507 G1 217 Y 14 55499476 GGACGA GGA small deletion Het probably benign 0.064 07/21/2015
83 333259 UTSW Carmil3 0.268 R4534 G1 217 N 14 55499476 GGACGA GGA small deletion Het probably benign 0.064 08/18/2015
84 333301 UTSW Carmil3 0.268 R4535 G1 217 N 14 55499476 GGACGA GGA small deletion Het probably benign 0.064 08/18/2015
85 342352 UTSW Carmil3 0.268 R4574 G1 217 Y 14 55499476 GGACGA GGA small deletion Het probably benign 0.064 09/24/2015
86 433735 UTSW Casc4 0.195 R5533 G1 217 N 2 121925697 AGATGGTGATGGTG AGATGGTG small deletion Het probably benign phenotype 10/06/2016
87 511111 UTSW Casz1 0.466 FR4340 138.72 N 4 148952302 ACCACAGCCACAGCCACAGCCAC ACCACAGCCACAGCCAC small deletion Homo probably benign phenotype 04/05/2018
88 67027 UTSW Casz1 0.466 R0550 G1 105 Y 4 148952284 GCCACCACCACCACCACCACCAC GCCACCACCACCACCACCAC small deletion Het probably benign 0.070 phenotype 08/20/2013
89 445312 UTSW Cbarp 0.167 R5761 G1 112 Y 10 80132233 CGCCTCTGCTGCCTCT CGCCTCT small deletion Het probably benign 11/21/2016
90 228054 UTSW Ccdc27 0.028 R2131 G1 128 N 4 154036306 TTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTC small deletion Het probably benign 09/17/2014
91 319813 UTSW Ccdc27 0.028 R4183 G1 148 N 4 154036306 TTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTC small deletion Het probably benign 06/10/2015
92 308560 UTSW Ccdc6 0.143 R3933 G1 217 Y 10 70189170 TCCGCCGCCGCC TCCGCCGCC small deletion Het probably benign 0.129 phenotype 04/17/2015
93 510957 UTSW Ccdc73 0.190 FR4304 182.46 N 2 104991840 TAAG T small deletion Homo probably benign 04/05/2018
94 511577 UTSW Ccdc73 0.190 FR4737 185.46 N 2 104991840 TAAG T small deletion Homo probably benign 04/05/2018
95 325676 UTSW Ccer1 0.047 R4364 G1 121 N 10 97694370 CGAGGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA small deletion Het probably benign 07/06/2015
96 512058 UTSW Cckbr 0.048 FR4548 146.51 N 7 105434681 GGGC G small deletion Homo probably benign phenotype 04/05/2018
97 511525 UTSW Ccnk 1.000 FR4449 217.47 N 12 108202507 TTCCCAC T small deletion Het probably benign phenotype 04/05/2018
98 511717 UTSW Ccnk 1.000 FR4737 217.47 N 12 108202507 TTCCCAC T small deletion Het probably benign phenotype 04/05/2018
99 511923 UTSW Ccnk 1.000 FR4976 217.47 N 12 108202507 TTCCCAC T small deletion Het probably benign phenotype 04/05/2018
100 512049 UTSW Cd3eap 0.796 FR4548 130.46 N 7 19357244 GGATG GG small deletion Homo probably benign 04/05/2018
[records 1 to 100 of 864] next >> last >|