Incidental Mutations

941 incidental mutations are currently displayed, and affect 409 genes.
0 are Possibly Damaging.
0 are Probably Damaging.
941 are Probably Benign.
0 are Probably Null.
0 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 941] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 66158 UTSW 1110002E22Rik 0.534 R0239 G1 153 N 3 138065834 TTCCTCCTCCTCCTCCTCCTCC TTCCTCCTCCTCCTCCTCC small deletion Het probably benign 08/19/2013
2 540719 UTSW 1700007K13Rik 0.068 R6819 G1 145.46 N 2 28466110 TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC small deletion Het probably benign phenotype 11/16/2018
3 566469 UTSW 1700007K13Rik 0.068 R7292 G1 154.49 Y 2 28466110 TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC small deletion Het probably benign phenotype 06/26/2019
4 570549 UTSW 1700007K13Rik 0.068 R7351 G1 110.47 Y 2 28466110 TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC small deletion Het probably benign phenotype 09/13/2019
5 576937 UTSW 1700007K13Rik 0.068 R7441 G1 178.46 N 2 28466110 TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC small deletion Het probably benign phenotype 10/07/2019
6 585619 UTSW 1700007K13Rik 0.068 R7569 G1 134.46 N 2 28466110 TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC small deletion Het probably benign phenotype 10/17/2019
7 589086 UTSW 1700007K13Rik 0.068 R7620 G1 102.46 N 2 28466110 TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC small deletion Het probably benign phenotype 10/24/2019
8 600557 UTSW 1700007K13Rik 0.068 R7802 G1 130.47 N 2 28466110 TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC small deletion Het probably benign phenotype 11/26/2019
9 609794 UTSW 1700007K13Rik 0.068 R7898 G1 185.46 N 2 28466110 TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC small deletion Het probably benign phenotype 12/20/2019
10 66840 UTSW 1700016K19Rik 0.000 R0025 G1 109 N 11 76000115 AGAGGAGGAGGAGGAGG AGAGGAGGAGGAGG small deletion Het probably benign 08/19/2013
11 535605 UTSW 1700021F05Rik 0.148 R6850 G1 217.47 Y 10 43532725 ACTGCACCACCT ACT small deletion Het probably benign 09/12/2018
12 535932 UTSW 1700021F05Rik 0.148 R6866 G1 217.47 N 10 43532725 ACTGCACCACCT ACT small deletion Het probably benign 10/18/2018
13 535983 UTSW 1700021F05Rik 0.148 R6867 G1 217.47 Y 10 43532725 ACTGCACCACCT ACT small deletion Het probably benign 10/18/2018
14 603162 UTSW 2300002M23Rik 0.116 RF010 G1 187.46 N 17 35568576 GGGTTATGGTCAGTACCCCCCAGTAGGGACCTGGGGCGGTTATGGTCAGTACCCCCCAGTAGGGCCCTGGGGCGGTTATGGTCAGTACCCCCCAGTAGGGACCTGGGG GGGTTATGGTCAGTACCCCCCAGTAGGGCCCTGGGGCGGTTATGGTCAGTACCCCCCAGTAGGGACCTGGGG small deletion Het probably benign phenotype 12/04/2019
15 605324 UTSW 3110021N24Rik RF058 G1 214.53 N 4 108780629 GAGCGCGGCC G small deletion Het probably benign 12/04/2019
16 270815 UTSW 4930402K13Rik 0.028 R3726 G1 214 Y X 9105103 AGAGGAG AGAG small deletion Het probably benign 03/18/2015
17 511007 UTSW 4930433I11Rik 0.066 FR4304 217.47 N 7 40993056 ACCTC AC small deletion Het probably benign 04/05/2018
18 511129 UTSW 4930433I11Rik 0.066 FR4340 217.47 N 7 40993055 AACC A small deletion Het probably benign 04/05/2018
19 511245 UTSW 4930433I11Rik 0.066 FR4342 186.47 N 7 40993055 AACC A small deletion Het probably benign 04/05/2018
20 512052 UTSW 4930433I11Rik 0.066 FR4548 217.47 N 7 40993056 ACCTC AC small deletion Het probably benign 04/05/2018
21 602626 UTSW 4930433I11Rik 0.066 RF003 G1 167.47 N 7 40993055 AACC A small deletion Het probably benign 12/04/2019
22 602686 UTSW 4930433I11Rik 0.066 RF004 G1 128.47 N 7 40993055 AACC A small deletion Het probably benign 12/04/2019
23 511032 UTSW 4930447C04Rik 0.214 FR4304 105.46 N 12 72881287 AAGT A small deletion Homo probably benign phenotype 04/05/2018
24 604833 UTSW 4930447C04Rik 0.214 RF041 G1 103.46 N 12 72881276 TGAGGA TGA small deletion Het probably benign phenotype 12/04/2019
25 510989 UTSW 4930548H24Rik 0.059 FR4304 214.46 N 5 31487373 GAGAAG GAG small deletion Homo probably benign 04/05/2018
26 511114 UTSW 4930548H24Rik 0.059 FR4340 217.47 N 5 31487373 GAGAAG GAG small deletion Het probably benign 04/05/2018
27 511231 UTSW 4930548H24Rik 0.059 FR4342 214.46 N 5 31487373 GAGAAG GAG small deletion Homo probably benign 04/05/2018
28 511339 UTSW 4930548H24Rik 0.059 FR4589 217.47 N 5 31487373 GAGAAG GAG small deletion Het probably benign 04/05/2018
29 478031 UTSW 4930548H24Rik 0.059 LCD18 G1 999 Y 5 31487373 GAGAAG GAG small deletion Het probably benign 05/17/2017
30 511690 UTSW 4932415D10Rik 0.069 FR4737 134.46 N 10 82285469 TTCA T small deletion Homo probably benign 04/05/2018
31 600678 UTSW 4933415A04Rik R7804 G1 125.47 Y 11 43587414 GTGTGTATGTGT GTGTGT small deletion Het probably benign 11/26/2019
32 152388 UTSW 6030419C18Rik 0.094 R1234 G1 101 N 9 58499432 AGAGGAGGAGGAGGAGG AGAGGAGGAGGAGG small deletion Het probably benign 01/29/2014
33 163221 UTSW 6030419C18Rik 0.094 R1385 G1 105 N 9 58499432 AGAGGAGGAGGAGGAGG AGAGGAGGAGGAGG small deletion Het probably benign 03/17/2014
34 307546 UTSW 6030419C18Rik 0.094 R3943 G1 124 Y 9 58499432 AGAGGAGGAGGAGGAGG AGAGGAGGAGGAGG small deletion Het probably benign 04/17/2015
35 344954 UTSW 6030419C18Rik 0.094 R4614 G1 105 Y 9 58499432 AGAGGAGGAGGAGGAGG AGAGGAGGAGGAGG small deletion Het probably benign 09/25/2015
36 603973 UTSW A030005L19Rik RF023 G1 169.23 N 1 82913396 TTGCTGTGGCTGTGGAGGTTGTGGCGGCTGTGGCTGTGG TGGCTGTGGCTGTGG small deletion Het probably benign 12/04/2019
37 605365 UTSW A030005L19Rik RF060 G1 117.72 N 1 82913396 TTGCTGTGGCTGTGGAGGTTGTGGCGGCTGTGGCTGTGG TGGCTGTGGCTGTGG small deletion Het probably benign 12/04/2019
38 62139 UTSW A230050P20Rik 0.320 R0669 G1 104 N 9 20873717 AGAGGAGGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGAGGAGGA small deletion Het probably benign 07/30/2013
39 169187 UTSW A230050P20Rik 0.320 R1500 G1 106 N 9 20873717 AGAGGAGGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGAGGAGGA small deletion Het probably benign 04/13/2014
40 265129 UTSW A230050P20Rik 0.320 R3055 G1 108 N 9 20873717 AGAGGAGGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGAGGAGGA small deletion Het probably benign 02/05/2015
41 519124 UTSW A430033K04Rik 0.073 R6444 G1 217.47 Y 5 138639569 ACAGAGCAGTGCCTACCAG ACAG small deletion Het probably benign 05/24/2018
42 511191 UTSW A530064D06Rik 0.000 FR4340 214.46 N 17 48163381 GTAGGAAGCTTAG GTAG small deletion Homo probably benign 04/05/2018
43 511426 UTSW A530064D06Rik 0.000 FR4589 214.46 N 17 48163381 GTAGGAAGCTTAG GTAG small deletion Homo probably benign 04/05/2018
44 272528 UTSW A630073D07Rik 0.147 R3791 G1 111 N 6 132626516 AGGTGGTGGTGGTGGTGGTGGTGG AGGTGGTGGTGGTGGTGGTGG small deletion Het probably benign 03/25/2015
45 197497 UTSW Aak1 0.517 Y4335 102 N 6 86959142 ACAGCAGCAGCAGCAGCAGCAGCAGC ACAGCAGCAGCAGCAGCAGCAGC small deletion Het probably benign phenotype 05/23/2014
46 601878 UTSW Abca7 0.000 R7821 G1 217.47 Y 10 80002590 TGGTGCGTGAG TG small deletion Het probably benign phenotype 12/03/2019
47 606349 UTSW Abcb11 0.494 R7842 G1 217.47 N 2 69323873 GTTGATCCATACA G small deletion Het probably benign phenotype 12/20/2019
48 609493 UTSW Abcb11 0.494 R7894 G1 217.47 N 2 69323873 GTTGATCCATACA G small deletion Het probably benign phenotype 12/20/2019
49 609733 UTSW Abcb11 0.494 R7897 G1 217.47 N 2 69323873 GTTGATCCATACA G small deletion Het probably benign phenotype 12/20/2019
50 609795 UTSW Abcb11 0.494 R7898 G1 217.47 N 2 69323873 GTTGATCCATACA G small deletion Het probably benign phenotype 12/20/2019
51 511627 UTSW Abcb4 0.000 FR4737 172.46 N 5 8896597 GAAA G small deletion Homo probably benign phenotype 04/05/2018
52 624919 UTSW Ablim2 0.246 Z1177 217.47 N 5 35841293 GATCGGTCCTA GA small deletion Het probably benign 01/23/2020
53 605188 UTSW Abra 0.266 RF053 G1 217.47 N 15 41866299 TGGC T small deletion Het probably benign phenotype 12/04/2019
54 512101 UTSW Abt1 0.960 FR4548 167.47 N 13 23423711 TTCTTGCT TT small deletion Het probably benign phenotype 04/05/2018
55 511928 UTSW Abt1 0.960 FR4976 115.47 N 13 23423711 TTCTTGCT TT small deletion Het probably benign phenotype 04/05/2018
56 66949 UTSW Acbd3 1.000 R0524 G1 106 N 1 180747059 CGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGA small deletion Het probably benign phenotype 08/19/2013
57 80999 UTSW Acbd3 1.000 R0884 G1 185 N 1 180747059 CGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGA small deletion Het probably benign phenotype 11/07/2013
58 604577 UTSW Adgra3 0.000 RF036 G1 115.92 N 5 50058641 GGCCGC GGC small deletion Het probably benign phenotype 12/04/2019
59 81607 UTSW Adgrb2 0.000 R0965 G1 112 N 4 129992416 AGAGGAGGAGGAGGAGGAGG AGAGGAGGAGGAGGAGG small deletion Het probably benign phenotype 11/08/2013
60 240955 UTSW AI593442 0.123 R2248 G1 138 N 9 52677814 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGA small deletion Het probably benign 10/15/2014
61 387126 UTSW AI593442 0.123 R5081 G1 133 N 9 52677814 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGA small deletion Het probably benign 06/06/2016
62 95062 UTSW Ak7 0.000 R1028 G1 127 N 12 105710189 AGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGA small deletion Het probably benign phenotype 01/05/2014
63 605073 UTSW Akna 0.095 RF048 G1 214.46 N 4 63377841 GAGCTGA G small deletion Het probably benign phenotype 12/04/2019
64 208442 UTSW Akp3 0.119 R1864 G1 102 N 1 87127767 TCACCACCACCACCACCACCACCACCACCAC TCACCACCACCACCACCACCACCACCAC small deletion Het probably benign phenotype 06/30/2014
65 602108 UTSW Akp3 0.119 R7825 G1 118.47 Y 1 87127767 TCACCACCACCACCACCACCACCACCACCAC TCACCACCACCACCACCACCACCACCAC small deletion Het probably benign phenotype 12/03/2019
66 604490 UTSW Alpk3 0.474 RF034 G1 217.47 N 7 81092414 GAGAAGGCAC G small deletion Het probably benign phenotype 12/04/2019
67 434793 UTSW Amer2 0.145 R5535 G1 103 N 14 60378853 AAGGAGGAGGAGGAG AAGGAGGAGGAG small deletion Het probably benign 10/24/2016
68 95048 UTSW Ano8 0.000 R1028 G1 104 N 8 71480971 GCCTCCTCCTCCTCCTC GCCTCCTCCTCCTC small deletion Het probably benign 01/05/2014
69 618670 UTSW Apbb1 0.000 R8044 G1 123.47 N 7 105573887 GTCCTCCTCCTCCTCCTCCTCCTC GTCCTCCTCCTCCTCCTCCTC small deletion Het probably benign phenotype 01/23/2020
70 603054 UTSW Arhgap17 0.000 RF009 G1 110.47 N 7 123286862 CTGTTGTTG CTGTTG small deletion Het probably benign phenotype 12/04/2019
71 603480 UTSW Arhgap17 0.000 RF015 G1 121.68 N 7 123286862 CTGTTGTTG CTGTTG small deletion Het probably benign phenotype 12/04/2019
72 262370 UTSW Arhgap28 0.000 R0811 G1 120 N 17 67901299 TCAGCAGCAGCAGCAGCAGCAG TCAGCAGCAGCAGCAGCAG small deletion Het probably benign phenotype 02/04/2015
73 500780 UTSW Arhgef10l 0.144 R3732 G1 108 N 4 140581619 AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA small deletion Het probably benign phenotype 12/01/2017
74 451402 UTSW Arhgef10l 0.144 R5720 G1 135 N 4 140581619 AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA small deletion Het probably benign phenotype 01/03/2017
75 162533 UTSW Arhgef17 0.000 R1389 G1 110 N 7 100931037 TGGAGGAGGAGGAGGAGG TGGAGGAGGAGGAGG small deletion Het probably benign 03/17/2014
76 603242 UTSW Arhgef4 0.000 RF012 G1 178.46 Y 1 34724484 CAAA C small deletion Het probably benign phenotype 12/04/2019
77 603259 UTSW Arid1a 1.000 RF012 G1 106.53 Y 4 133752820 AGACGACGA AGACGA small deletion Het probably benign phenotype 12/04/2019
78 603460 UTSW Arid1a 1.000 RF015 G1 107.67 N 4 133752831 AGGC A small deletion Het probably benign phenotype 12/04/2019
79 368164 UTSW Atoh7 0.723 R4779 G1 217 Y 10 63100408 ATGGCGCT AT small deletion Het probably benign phenotype 12/29/2015
80 329046 UTSW Atp10a 0.318 R4453 G1 167 N 7 58658500 TGGCGGCGGC TGGCGGC small deletion Het probably benign p23DFiOD deletion may be responsible for the obesity phenotypes associated with that deletion. [provided by MGI curators] (source: MGI)">phenotype 07/21/2015
81 352851 UTSW Atp10a 0.318 R4661 G1 217 N 7 58658500 TGGCGGCGGC TGGCGGC small deletion Het probably benign p23DFiOD deletion may be responsible for the obesity phenotypes associated with that deletion. [provided by MGI curators] (source: MGI)">phenotype 10/08/2015
82 167236 UTSW Atp2b3 0.000 R1518 G1 214 N X 73545123 GACAACA GACA small deletion Het probably benign phenotype 04/13/2014
83 625834 UTSW Atp4b 0.000 Z1177 217.47 N 8 13396684 GGTTCCAACAGTAGT GGT small deletion Het probably benign phenotype 01/23/2020
84 94723 UTSW Atxn2l 0.896 R1132 G1 110 N 7 126494248 CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC small deletion Het probably benign phenotype 01/05/2014
85 517567 UTSW Atxn2l 0.896 R6460 G1 136.47 N 7 126494248 CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC small deletion Het probably benign phenotype 05/21/2018
86 604453 UTSW AY761185 0.069 RF033 G1 217.47 N 8 20943888 CCCGGGCACT C small deletion Het probably benign 12/04/2019
87 486101 UTSW Baz2a 0.000 R6088 G1 217.47 Y 10 128114642 TCTCCTC TCTC small deletion Het probably benign 08/16/2017
88 484669 UTSW Baz2a 0.000 R6089 G1 217.47 N 10 128114642 TCTCCTC TCTC small deletion Het probably benign 08/16/2017
89 606686 UTSW BB014433 0.066 R7847 G1 217.47 Y 8 15042160 GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG small deletion Het probably benign 12/20/2019
90 607365 UTSW BB014433 0.066 R7859 G1 217.47 N 8 15042160 GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG small deletion Het probably benign 12/20/2019
91 315084 UTSW Blm 1.000 R4155 G1 127 N 7 80512904 GCCTCCTCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCCTCCTCC small deletion Het probably benign phenotype 05/14/2015
92 489970 UTSW Blm 1.000 R6163 G1 102.47 N 7 80512904 GCCTCCTCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCCTCCTCC small deletion Het probably benign phenotype 10/10/2017
93 519192 UTSW Blm 1.000 R6446 G1 111.47 N 7 80512904 GCCTCCTCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCCTCCTCC small deletion Het probably benign phenotype 05/24/2018
94 511891 UTSW Bmp5 0.488 FR4976 216.23 N 9 75776375 GAGGAGT G small deletion Homo probably benign phenotype 04/05/2018
95 605185 UTSW Bmp5 0.488 RF053 G1 214.47 N 9 75776374 TGAGGAG T small deletion Het probably benign phenotype 12/04/2019
96 262446 UTSW Bmp6 0.000 R1218 G1 116 N 13 38346250 ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAGCAGCAGCAGCAG small deletion Het probably benign phenotype 02/04/2015
97 202034 UTSW Brdt 0.000 R1794 G1 111 N 5 107359853 ACAGCAGCAGCAGCAGC ACAGCAGCAGCAGC small deletion Het probably benign phenotype 06/23/2014
98 601589 UTSW Brpf1 0.963 R7817 G1 192.47 N 6 113320539 CCAGCAGCAGCAGCAGCAGCAG CCAGCAGCAGCAGCAGCAG small deletion Het probably benign phenotype 12/03/2019
99 402509 UTSW Btbd11 0.256 R5224 G1 217 Y 10 85645522 CGTGACCTTTCTGGT CGT small deletion Het probably benign 0.090 07/22/2016
100 528611 UTSW C2cd6 0.053 R6697 G1 217.47 N 1 59051088 ATGTGGCCTGTCTTCT A small deletion Het probably benign 07/24/2018
[records 1 to 100 of 941] next >> last >|