Incidental Mutations

700 incidental mutations are currently displayed, and affect 335 genes.
0 are Possibly Damaging.
0 are Probably Damaging.
700 are Probably Benign.
0 are Probably Null.
0 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 700] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 66158 UTSW 1110002E22Rik 0.536 R0239 G1 153 N 3 138065834 TTCCTCCTCCTCCTCCTCCTCC TTCCTCCTCCTCCTCCTCC small deletion Het probably benign 08/19/2013
2 540719 UTSW 1700007K13Rik 0.070 R6819 G1 145.46 N 2 28466110 TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC small deletion Het probably benign phenotype 11/16/2018
3 566469 UTSW 1700007K13Rik 0.070 R7292 G1 154.49 N 2 28466110 TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC small deletion Het probably benign phenotype 06/26/2019
4 570549 UTSW 1700007K13Rik 0.070 R7351 G1 110.47 N 2 28466110 TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC small deletion Het probably benign phenotype 09/13/2019
5 576937 UTSW 1700007K13Rik 0.070 R7441 G1 178.46 N 2 28466110 TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC small deletion Het probably benign phenotype 10/07/2019
6 585619 UTSW 1700007K13Rik 0.070 R7569 G1 134.46 N 2 28466110 TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC small deletion Het probably benign phenotype 10/17/2019
7 66840 UTSW 1700016K19Rik 0.000 R0025 G1 109 N 11 76000115 AGAGGAGGAGGAGGAGG AGAGGAGGAGGAGG small deletion Het probably benign 08/19/2013
8 535605 UTSW 1700021F05Rik 0.118 R6850 G1 217.47 Y 10 43532725 ACTGCACCACCT ACT small deletion Het probably benign 09/12/2018
9 535932 UTSW 1700021F05Rik 0.118 R6866 G1 217.47 N 10 43532725 ACTGCACCACCT ACT small deletion Het probably benign 10/18/2018
10 535983 UTSW 1700021F05Rik 0.118 R6867 G1 217.47 Y 10 43532725 ACTGCACCACCT ACT small deletion Het probably benign 10/18/2018
11 270815 UTSW 4930402K13Rik 0.028 R3726 G1 214 Y X 9105103 AGAGGAG AGAG small deletion Het probably benign 03/18/2015
12 511007 UTSW 4930433I11Rik 0.071 FR4304 217.47 N 7 40993056 ACCTC AC small deletion Het probably benign 04/05/2018
13 511129 UTSW 4930433I11Rik 0.071 FR4340 217.47 N 7 40993055 AACC A small deletion Het probably benign 04/05/2018
14 511245 UTSW 4930433I11Rik 0.071 FR4342 186.47 N 7 40993055 AACC A small deletion Het probably benign 04/05/2018
15 512052 UTSW 4930433I11Rik 0.071 FR4548 217.47 N 7 40993056 ACCTC AC small deletion Het probably benign 04/05/2018
16 511032 UTSW 4930447C04Rik 0.211 FR4304 105.46 N 12 72881287 AAGT A small deletion Homo probably benign phenotype 04/05/2018
17 510989 UTSW 4930548H24Rik 0.070 FR4304 214.46 N 5 31487373 GAGAAG GAG small deletion Homo probably benign 04/05/2018
18 511114 UTSW 4930548H24Rik 0.070 FR4340 217.47 N 5 31487373 GAGAAG GAG small deletion Het probably benign 04/05/2018
19 511231 UTSW 4930548H24Rik 0.070 FR4342 214.46 N 5 31487373 GAGAAG GAG small deletion Homo probably benign 04/05/2018
20 511339 UTSW 4930548H24Rik 0.070 FR4589 217.47 N 5 31487373 GAGAAG GAG small deletion Het probably benign 04/05/2018
21 478031 UTSW 4930548H24Rik 0.070 LCD18 G1 999 Y 5 31487373 GAGAAG GAG small deletion Het probably benign 05/17/2017
22 511690 UTSW 4932415D10Rik 0.084 FR4737 134.46 N 10 82285469 TTCA T small deletion Homo probably benign 04/05/2018
23 152388 UTSW 6030419C18Rik 0.063 R1234 G1 101 N 9 58499432 AGAGGAGGAGGAGGAGG AGAGGAGGAGGAGG small deletion Het probably benign 01/29/2014
24 163221 UTSW 6030419C18Rik 0.063 R1385 G1 105 N 9 58499432 AGAGGAGGAGGAGGAGG AGAGGAGGAGGAGG small deletion Het probably benign 03/17/2014
25 307546 UTSW 6030419C18Rik 0.063 R3943 G1 124 Y 9 58499432 AGAGGAGGAGGAGGAGG AGAGGAGGAGGAGG small deletion Het probably benign 04/17/2015
26 344954 UTSW 6030419C18Rik 0.063 R4614 G1 105 Y 9 58499432 AGAGGAGGAGGAGGAGG AGAGGAGGAGGAGG small deletion Het probably benign 09/25/2015
27 62139 UTSW A230050P20Rik 0.320 R0669 G1 104 N 9 20873717 AGAGGAGGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGAGGAGGA small deletion Het probably benign 07/30/2013
28 169187 UTSW A230050P20Rik 0.320 R1500 G1 106 N 9 20873717 AGAGGAGGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGAGGAGGA small deletion Het probably benign 04/13/2014
29 265129 UTSW A230050P20Rik 0.320 R3055 G1 108 N 9 20873717 AGAGGAGGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGAGGAGGA small deletion Het probably benign 02/05/2015
30 519124 UTSW A430033K04Rik 0.065 R6444 G1 217.47 Y 5 138639569 ACAGAGCAGTGCCTACCAG ACAG small deletion Het probably benign 05/24/2018
31 511191 UTSW A530064D06Rik 0.000 FR4340 214.46 N 17 48163381 GTAGGAAGCTTAG GTAG small deletion Homo probably benign 04/05/2018
32 511426 UTSW A530064D06Rik 0.000 FR4589 214.46 N 17 48163381 GTAGGAAGCTTAG GTAG small deletion Homo probably benign 04/05/2018
33 272528 UTSW A630073D07Rik 0.150 R3791 G1 111 N 6 132626516 AGGTGGTGGTGGTGGTGGTGGTGG AGGTGGTGGTGGTGGTGGTGG small deletion Het probably benign 03/25/2015
34 197497 UTSW Aak1 0.433 Y4335 102 N 6 86959142 ACAGCAGCAGCAGCAGCAGCAGCAGC ACAGCAGCAGCAGCAGCAGCAGC small deletion Het probably benign phenotype 05/23/2014
35 511627 UTSW Abcb4 0.000 FR4737 172.46 N 5 8896597 GAAA G small deletion Homo probably benign phenotype 04/05/2018
36 512101 UTSW Abt1 0.963 FR4548 167.47 N 13 23423711 TTCTTGCT TT small deletion Het probably benign phenotype 04/05/2018
37 511928 UTSW Abt1 0.963 FR4976 115.47 N 13 23423711 TTCTTGCT TT small deletion Het probably benign phenotype 04/05/2018
38 66949 UTSW Acbd3 1.000 R0524 G1 106 N 1 180747059 CGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGA small deletion Het probably benign phenotype 08/19/2013
39 80999 UTSW Acbd3 1.000 R0884 G1 185 N 1 180747059 CGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGA small deletion Het probably benign phenotype 11/07/2013
40 81607 UTSW Adgrb2 0.000 R0965 G1 112 N 4 129992416 AGAGGAGGAGGAGGAGGAGG AGAGGAGGAGGAGGAGG small deletion Het probably benign phenotype 11/08/2013
41 240955 UTSW AI593442 0.127 R2248 G1 138 N 9 52677814 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGA small deletion Het probably benign 10/15/2014
42 387126 UTSW AI593442 0.127 R5081 G1 133 N 9 52677814 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGA small deletion Het probably benign 06/06/2016
43 95062 UTSW Ak7 0.000 R1028 G1 127 N 12 105710189 AGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGA small deletion Het probably benign phenotype 01/05/2014
44 208442 UTSW Akp3 0.129 R1864 G1 102 N 1 87127767 TCACCACCACCACCACCACCACCACCACCAC TCACCACCACCACCACCACCACCACCAC small deletion Het probably benign phenotype 06/30/2014
45 434793 UTSW Amer2 0.186 R5535 G1 103 N 14 60378853 AAGGAGGAGGAGGAG AAGGAGGAGGAG small deletion Het probably benign 10/24/2016
46 95048 UTSW Ano8 0.000 R1028 G1 104 N 8 71480971 GCCTCCTCCTCCTCCTC GCCTCCTCCTCCTC small deletion Het probably benign 01/05/2014
47 262370 UTSW Arhgap28 0.000 R0811 G1 120 N 17 67901299 TCAGCAGCAGCAGCAGCAGCAG TCAGCAGCAGCAGCAGCAG small deletion Het probably benign phenotype 02/04/2015
48 500780 UTSW Arhgef10l 0.146 R3732 G1 108 N 4 140581619 AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA small deletion Het probably benign phenotype 12/01/2017
49 451402 UTSW Arhgef10l 0.146 R5720 G1 135 N 4 140581619 AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA small deletion Het probably benign phenotype 01/03/2017
50 162533 UTSW Arhgef17 0.000 R1389 G1 110 N 7 100931037 TGGAGGAGGAGGAGGAGG TGGAGGAGGAGGAGG small deletion Het probably benign 03/17/2014
51 368164 UTSW Atoh7 0.667 R4779 G1 217 Y 10 63100408 ATGGCGCT AT small deletion Het probably benign phenotype 12/29/2015
52 329046 UTSW Atp10a 0.268 R4453 G1 167 N 7 58658500 TGGCGGCGGC TGGCGGC small deletion Het probably benign p23DFiOD deletion may be responsible for the obesity phenotypes associated with that deletion. [provided by MGI curators] (source: MGI)">phenotype 07/21/2015
53 352851 UTSW Atp10a 0.268 R4661 G1 217 N 7 58658500 TGGCGGCGGC TGGCGGC small deletion Het probably benign p23DFiOD deletion may be responsible for the obesity phenotypes associated with that deletion. [provided by MGI curators] (source: MGI)">phenotype 10/08/2015
54 167236 UTSW Atp2b3 0.000 R1518 G1 214 N X 73545123 GACAACA GACA small deletion Het probably benign phenotype 04/13/2014
55 94723 UTSW Atxn2l 0.875 R1132 G1 110 N 7 126494248 CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC small deletion Het probably benign phenotype 01/05/2014
56 517567 UTSW Atxn2l 0.875 R6460 G1 136.47 N 7 126494248 CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC small deletion Het probably benign phenotype 05/21/2018
57 486101 UTSW Baz2a 0.000 R6088 G1 217.47 Y 10 128114642 TCTCCTC TCTC small deletion Het probably benign 08/16/2017
58 484669 UTSW Baz2a 0.000 R6089 G1 217.47 N 10 128114642 TCTCCTC TCTC small deletion Het probably benign 08/16/2017
59 315084 UTSW Blm 1.000 R4155 G1 127 N 7 80512904 GCCTCCTCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCCTCCTCC small deletion Het probably benign phenotype 05/14/2015
60 489970 UTSW Blm 1.000 R6163 G1 102.47 N 7 80512904 GCCTCCTCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCCTCCTCC small deletion Het probably benign phenotype 10/10/2017
61 519192 UTSW Blm 1.000 R6446 G1 111.47 N 7 80512904 GCCTCCTCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCCTCCTCC small deletion Het probably benign phenotype 05/24/2018
62 511891 UTSW Bmp5 0.461 FR4976 216.23 N 9 75776375 GAGGAGT G small deletion Homo probably benign phenotype 04/05/2018
63 262446 UTSW Bmp6 0.000 R1218 G1 116 N 13 38346250 ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAGCAGCAGCAGCAG small deletion Het probably benign phenotype 02/04/2015
64 202034 UTSW Brdt 0.000 R1794 G1 111 N 5 107359853 ACAGCAGCAGCAGCAGC ACAGCAGCAGCAGC small deletion Het probably benign phenotype 06/23/2014
65 402509 UTSW Btbd11 0.238 R5224 G1 217 Y 10 85645522 CGTGACCTTTCTGGT CGT small deletion Het probably benign 0.064 07/22/2016
66 528611 UTSW C2cd6 0.059 R6697 G1 217.47 N 1 59051088 ATGTGGCCTGTCTTCT A small deletion Het probably benign 07/24/2018
67 545371 UTSW C530008M17Rik 0.000 R7017 G1 199.47 N 5 76856948 GAGGCAGCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG GAGACAACGCGAGGCCGAGAGGCAGG small deletion Het probably benign 05/13/2019
68 573650 UTSW C530008M17Rik 0.000 R7394 G1 152.47 N 5 76856954 GCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG GCGCGAGGCCGAGAGGCAGG small deletion Het probably benign 09/13/2019
69 580546 UTSW C530008M17Rik 0.000 R7436 G1 121.47 N 5 76856954 GCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG GCGCGAGGCCGAGAGGCAGG small deletion Het probably benign 10/07/2019
70 544299 UTSW Calcoco2 0.000 R6997 G1 105.49 N 11 96099982 GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC small deletion Het probably benign 05/13/2019
71 555935 UTSW Card6 0.000 PIT4458001 G1 100.49 N 15 5098691 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG small deletion Het probably benign phenotype 06/07/2019
72 552770 UTSW Card6 0.000 R7132 G1 214.46 N 15 5098691 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG small deletion Het probably benign phenotype 05/15/2019
73 558511 UTSW Card6 0.000 R7174 G1 214.46 N 15 5098691 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG small deletion Het probably benign phenotype 06/26/2019
74 559325 UTSW Card6 0.000 R7186 G1 214.46 Y 15 5098691 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG small deletion Het probably benign phenotype 06/26/2019
75 511111 UTSW Casz1 1.000 FR4340 138.72 N 4 148952302 ACCACAGCCACAGCCACAGCCAC ACCACAGCCACAGCCAC small deletion Homo probably benign phenotype 04/05/2018
76 67027 UTSW Casz1 1.000 R0550 G1 105 Y 4 148952284 GCCACCACCACCACCACCACCAC GCCACCACCACCACCACCAC small deletion Het probably benign 0.070 phenotype 08/20/2013
77 228054 UTSW Ccdc27 0.063 R2131 G1 128 N 4 154036306 TTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTC small deletion Het probably benign 09/17/2014
78 319813 UTSW Ccdc27 0.063 R4183 G1 148 N 4 154036306 TTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTC small deletion Het probably benign 06/10/2015
79 325676 UTSW Ccer1 0.058 R4364 G1 121 N 10 97694370 CGAGGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA small deletion Het probably benign 07/06/2015
80 512058 UTSW Cckbr 0.074 FR4548 146.51 N 7 105434681 GGGC G small deletion Homo probably benign phenotype 04/05/2018
81 556119 UTSW Cd300ld2 0.000 PIT4486001 G1 132.46 N 11 115012431 CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG small deletion Het probably benign 06/07/2019
82 156352 UTSW Cdc14a 0.271 R1363 G1 101 N 3 116293860 CGCTGCTGCTGCTGCTGCTG CGCTGCTGCTGCTGCTG small deletion Het probably benign phenotype 02/11/2014
83 348832 UTSW Cdca7 0.141 R4627 G1 161 N 2 72481861 TGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGA TGAAGAAGAAGAAGAAGAAGAAGAAGAAGA small deletion Het probably benign phenotype 10/08/2015
84 378083 UTSW Cdca7 0.141 R4905 G1 121 N 2 72481861 TGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGA TGAAGAAGAAGAAGAAGAAGAAGAAGAAGA small deletion Het probably benign phenotype 04/15/2016
85 555813 UTSW Cdr1 0.070 PIT4466001 G1 214.46 N X 61184524 AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC small deletion Het probably benign 06/07/2019
86 61387 UTSW Celf3 0.249 R0670 G1 107 N 3 94488230 ACAGCAGCAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCAGCAGCA small deletion Het probably benign phenotype 07/30/2013
87 254446 UTSW Celf3 0.249 R2566 G1 140 N 3 94488230 ACAGCAGCAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCAGCAGCA small deletion Het probably benign phenotype 12/04/2014
88 382890 UTSW Celf3 0.249 R4939 G1 122 N 3 94488230 ACAGCAGCAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCAGCAGCA small deletion Het probably benign phenotype 04/27/2016
89 398090 UTSW Cep135 1.000 R5233 G1 217 Y 5 76591843 AGTCTGCCTTTGG A small deletion Het probably benign phenotype 07/06/2016
90 385265 UTSW Cgnl1 0.000 R4996 G1 217 N 9 71724826 CTTGCCCAGGTT CTT small deletion Het probably benign phenotype 05/10/2016
91 501763 UTSW Chd5 0.000 R6039 G1 103.47 N 4 152353621 CAAGAAGAAGAAGAAGAA CAAGAAGAAGAAGAA small deletion Het probably benign phenotype 12/01/2017
92 265791 UTSW Chd6 0.737 R3025 G1 213 N 2 160966552 GATCAT GAT small deletion Het probably benign phenotype 02/05/2015
93 268860 UTSW Cherp 0.963 R3693 G1 106 Y 8 72467911 TTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTG small deletion Het probably benign 02/19/2015
94 444689 UTSW Cherp 0.963 R5739 G1 217 Y 8 72467815 TGCTGGTGGTGGGG TG small deletion Het probably benign 11/21/2016
95 262118 UTSW Cherp 0.963 T0722 G3 217 N 711 8 72462034 TTGGACCTGGACCTGGACCTGGACCTGGA TTGGACCTGGACCTGGACCTGGA small deletion Het probably benign 02/04/2015
96 262162 UTSW Cherp 0.963 T0975 G3 154 N 714 8 72462034 TTGGACCTGGACCTGGACCTGGACCTGGA TTGGACCTGGACCTGGACCTGGA small deletion Het probably benign 02/04/2015
97 353098 UTSW Cic 0.894 R4664 G1 217 Y 7 25290674 TGTTGCCCTC T small deletion Het probably benign phenotype 10/08/2015
98 157943 UTSW Ckb 0.000 R1311 G1 128 Y 12 111669645 TCCACCACCA TCCACCA small deletion Het probably benign 0.062 phenotype 02/18/2014
99 308201 UTSW Ckb 0.000 R1888 G1 217 Y 12 111669645 TCCACCACCA TCCACCA small deletion Het probably benign 0.062 phenotype 04/17/2015
100 211525 UTSW Ckb 0.000 R1891 G1 215 N 12 111669645 TCCACCACCA TCCACCA small deletion Het probably benign 0.062 phenotype 06/30/2014
[records 1 to 100 of 700] next >> last >|