Incidental Mutation 'R3024:Olfr1262'
List |< first << previous [record 10 of 23] next >> last >|
ID265767
Institutional Source Beutler Lab
Gene Symbol Olfr1262
Ensembl Gene ENSMUSG00000051313
Gene Nameolfactory receptor 1262
SynonymsGA_x6K02T2Q125-51434523-51435437, MOR234-1
MMRRC Submission 040540-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R3024 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location90000145-90008291 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 90003240 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 278 (N278I)
Ref Sequence ENSEMBL: ENSMUSP00000107133 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061701] [ENSMUST00000111508] [ENSMUST00000131072] [ENSMUST00000213868]
Predicted Effect probably damaging
Transcript: ENSMUST00000061701
AA Change: N278I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052387
Gene: ENSMUSG00000051313
AA Change: N278I

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 30 297 1.2e-5 PFAM
Pfam:7tm_1 36 282 9.9e-24 PFAM
Pfam:7tm_4 134 275 1.3e-38 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111508
AA Change: N278I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107133
Gene: ENSMUSG00000051313
AA Change: N278I

DomainStartEndE-ValueType
Pfam:7tm_4 25 300 6.1e-43 PFAM
Pfam:7TM_GPCR_Srsx 30 297 1.2e-5 PFAM
Pfam:7tm_1 36 282 7.1e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131072
SMART Domains Protein: ENSMUSP00000121666
Gene: ENSMUSG00000051313

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 30 171 1.7e-8 PFAM
Pfam:7tm_1 36 238 3.2e-22 PFAM
Pfam:7tm_4 134 240 5e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213868
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef37 T C 18: 61,501,888 E461G probably damaging Het
Bfsp1 A T 2: 143,845,959 V182D probably benign Het
Birc6 T C 17: 74,608,219 S1635P possibly damaging Het
Chil6 T C 3: 106,388,770 D383G probably damaging Het
Itpr2 G A 6: 146,180,310 A175V probably benign Het
Kcnh7 G T 2: 62,764,663 R688S probably damaging Het
Krt6a A T 15: 101,691,289 C463S probably benign Het
Ksr2 T A 5: 117,555,060 I191N possibly damaging Het
Lyst T C 13: 13,658,687 V1698A probably benign Het
Olfr103 A T 17: 37,337,027 D68E probably damaging Het
Pappa2 C T 1: 158,936,225 R572Q probably benign Het
Pes1 CGGAGGAGGAGGAGGAGGAGGAGG CGGAGGAGGAGGAGGAGGAGG 11: 3,977,719 probably benign Het
Phf20 A G 2: 156,287,867 H453R probably damaging Het
Prex1 G T 2: 166,589,036 H615Q probably benign Het
Slc25a54 T A 3: 109,080,666 I41N probably damaging Het
Slc35f5 A G 1: 125,568,598 S157G probably benign Het
Sstr3 G A 15: 78,539,987 R187W probably damaging Het
Trim41 T C 11: 48,808,158 K420E possibly damaging Het
Tsnaxip1 A G 8: 105,841,743 Y353C probably damaging Het
Vmn1r238 T C 18: 3,123,305 I36M probably benign Het
Xylt1 T A 7: 117,548,648 V149D probably damaging Het
Zfpm2 G A 15: 41,102,959 E815K probably benign Het
Other mutations in Olfr1262
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Olfr1262 APN 2 90003021 missense possibly damaging 0.65
IGL03303:Olfr1262 APN 2 90002466 missense possibly damaging 0.88
R1216:Olfr1262 UTSW 2 90002478 missense probably benign 0.23
R1256:Olfr1262 UTSW 2 90002567 missense possibly damaging 0.61
R1860:Olfr1262 UTSW 2 90003146 missense probably benign 0.26
R1864:Olfr1262 UTSW 2 90002481 missense probably benign 0.02
R1918:Olfr1262 UTSW 2 90002574 missense probably benign 0.12
R2192:Olfr1262 UTSW 2 90002430 missense probably damaging 0.99
R4155:Olfr1262 UTSW 2 90002660 missense probably benign 0.35
R4956:Olfr1262 UTSW 2 90002843 missense probably benign 0.33
R5298:Olfr1262 UTSW 2 90002460 missense possibly damaging 0.92
R5804:Olfr1262 UTSW 2 90002988 missense possibly damaging 0.91
R6766:Olfr1262 UTSW 2 90002532 missense probably benign 0.06
R7674:Olfr1262 UTSW 2 90003045 missense probably damaging 0.99
Z1176:Olfr1262 UTSW 2 90003048 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ACAGCGGGTCAATGTGTTTACTC -3'
(R):5'- CCTGTGCTAATTCTGGTACAAAATG -3'

Sequencing Primer
(F):5'- TTCGCTCCCTAAGGAATCACAGTG -3'
(R):5'- GGTATTCCTGCCTTGCTA -3'
Posted On2015-02-05