Incidental Mutation 'R4408:Gml2'
List |< first << previous [record 10 of 32] next >> last >|
ID327774
Institutional Source Beutler Lab
Gene Symbol Gml2
Ensembl Gene ENSMUSG00000068600
Gene Nameglycosylphosphatidylinositol anchored molecule like 2
SynonymsHemt1, hematopoietic cell-specific transcript, HemT, 1700057K19Rik
MMRRC Submission 041690-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R4408 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location74819071-74834871 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 74824339 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096399] [ENSMUST00000188180]
Predicted Effect probably benign
Transcript: ENSMUST00000096399
SMART Domains Protein: ENSMUSP00000094130
Gene: ENSMUSG00000068600

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
LU 47 141 2.06e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186752
Predicted Effect probably benign
Transcript: ENSMUST00000188180
SMART Domains Protein: ENSMUSP00000141185
Gene: ENSMUSG00000068600

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Blast:LU 47 80 2e-15 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188458
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 97% (35/36)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cacna1h A G 17: 25,380,627 V1588A probably damaging Het
Card6 T A 15: 5,101,054 M287L probably damaging Het
Fam227b T A 2: 126,116,125 Y240F possibly damaging Het
Fbln1 T A 15: 85,231,556 probably null Het
Fndc5 A G 4: 129,142,529 probably null Het
Gm10799 C A 2: 104,068,064 A99S possibly damaging Het
Gm27013 A T 6: 130,677,765 S245T possibly damaging Het
Gm5592 A G 7: 41,286,448 T125A probably benign Het
Gpbp1 A T 13: 111,448,964 N149K possibly damaging Het
Gprc6a T C 10: 51,628,543 I68M probably benign Het
Hnrnpu T C 1: 178,330,803 probably benign Het
Irf5 A G 6: 29,534,001 probably null Het
Lrp2 T A 2: 69,467,169 K3149N probably benign Het
Lrrn3 A G 12: 41,454,042 V92A probably benign Het
Map3k12 T C 15: 102,505,402 T45A probably damaging Het
Myof A G 19: 37,922,978 S1502P probably damaging Het
Olfr1283 T A 2: 111,369,280 I216K possibly damaging Het
Olfr466 A G 13: 65,152,700 T159A probably benign Het
Osr2 T C 15: 35,300,471 Y58H possibly damaging Het
Pop5 C T 5: 115,240,777 probably benign Het
Ror2 A G 13: 53,118,961 C211R probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sgsm2 C A 11: 74,851,766 R957L probably damaging Het
Slc16a11 A G 11: 70,215,734 probably null Het
Spag17 T A 3: 100,103,378 Y2063N probably benign Het
Usp25 A C 16: 77,115,453 K1020T probably damaging Het
Vmn1r23 T C 6: 57,926,368 I142V probably benign Het
Vmn1r235 A G 17: 21,261,592 K60E probably damaging Het
Vmn2r33 A C 7: 7,551,230 F775V probably damaging Het
Vps13b C T 15: 35,709,294 P1796S probably damaging Het
Vwa3a G A 7: 120,778,926 V480I probably benign Het
Other mutations in Gml2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01649:Gml2 APN 15 74824221 nonsense probably null
R0031:Gml2 UTSW 15 74824276 missense probably benign 0.12
R0608:Gml2 UTSW 15 74821386 critical splice donor site probably null
R1087:Gml2 UTSW 15 74824097 missense possibly damaging 0.73
R1130:Gml2 UTSW 15 74821346 missense probably damaging 0.99
R1503:Gml2 UTSW 15 74821352 nonsense probably null
R6802:Gml2 UTSW 15 74824246 missense probably damaging 1.00
R7351:Gml2 UTSW 15 74821376 missense possibly damaging 0.57
R7833:Gml2 UTSW 15 74821368 nonsense probably null
R7910:Gml2 UTSW 15 74820530 critical splice acceptor site probably null
R8513:Gml2 UTSW 15 74824155 missense probably damaging 1.00
R8695:Gml2 UTSW 15 74824240 missense probably benign 0.05
X0066:Gml2 UTSW 15 74824050 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTATAACTTGCAATGTGGGAGGC -3'
(R):5'- CTCCTAAGGTGATGGAGTAGGG -3'

Sequencing Primer
(F):5'- CCCCACTAATTTAGAGAGGGACTTG -3'
(R):5'- TAGGGATGACCAAATCTGAGC -3'
Posted On2015-07-07